Murine primer sequences
GeneForward qPCR
primer sequence
Reverse qPCR
primer sequence
Rplp2TACGTCGCCTCTTACCTGCTGACCTTGTTGAGCCGATCAT
Il13CCTCTGACCCTTAAGGAGCTTATCGTTGCACAGGGGAGTCT
CCL11GAATCACCAACAACAGATGCACATCCTGGACCCACTTCTTCTT
Muc5acCAGGACTCTCTGAAATCGTACCAAAGGCTCGTACCACAGGGA
Clca3AGGAAAACCCCAAGCAGTGGCACCGACGAACTTGATTTT
Il17CAGACTACCTCAACCGTTCCAGCATCTTCTCGACCCTGAA
Cxcl1CTGGGATTCACCTCAAGAACGAAGCCAGCGTTCACCAGAC
Cxcl3CCCCAGGCTTCAGATAATCATCTGATTTAGAATGCAGGTCCTT
Csf3GTGCTGCTGGAGCAGTTGTTCGGGATCCCCAGAGAGT
IL4ACGAGGTCACAGGAGAAGGGAAGCCCTACAGACGAGCTCACTC