Research ArticleAsthma

TH2 and TH17 inflammatory pathways are reciprocally regulated in asthma

See allHide authors and affiliations

Science Translational Medicine  19 Aug 2015:
Vol. 7, Issue 301, pp. 301ra129
DOI: 10.1126/scitranslmed.aab3142
  • Fig. 1. IL-13 and IL-17A induce TH2 and TH17 signature genes in NHBE cells.

    NHBE cells were grown and differentiated at ALI and then stimulated for 24 hours with IL-13 (10 ng/ml), IL-17A (10 ng/ml), TNF-α (10 ng/ml), or IL-17A (10 ng/ml) and TNF-α (10 ng/ml) (n = 3 technical replicates). Gene expression was assessed by quantitative polymerase chain reaction (qPCR). Differential expression is represented by heatmap of averaged replicates of untreated control zero-centered and scaled values.

  • Fig. 2. Three distinct asthma subgroups are defined by mutually exclusive TH2 and TH17 signature expression.

    (A and B) The expression of endobronchial biopsy (A) TH2 and (B) TH17 signature scores is significantly elevated (P < 0.05, Kruskal-Wallis) in samples with detectable IL13 and IL17A, respectively. (C) TH2 and TH17 scores from 51 asthmatic bronchial biopsy microarrays are plotted by scatterplot. TH2 and TH17 signature scores are inversely correlated (Spearman’s ρ = −0.35, P = 0.011). Clustering TH2 and TH17 scores was used to classify subjects as TH2 score dominant (TH2-high, red), TH17 score dominant (TH17-high, blue), and TH2/17 score low (TH2/17-low, gray).

  • Fig. 3. TH2-high and TH17-high asthma are both associated with elevated levels of physiologic TH2/eosinophilic measures of inflammation.

    Pairwise comparisons (Mann-Whitney test) were made among TH2/17-low (Low), TH2-high (TH2), and TH17-high (TH17) asthmatics subjects. Red font indicates P < 0.05. (A and B) TH2-high subjects were associated with elevated (A) FeNO and (B) sputum eosinophil percentage as compared to low-inflammatory and TH17-high asthma. (C) Blood eosinophils were elevated in TH2-high versus low-inflammatory asthma. (D) Lamina propria eosinophil counts were elevated in both TH2-high and TH17-high versus low-inflammatory asthma. (E) Median levels of serum periostin were highest in TH17-high versus TH2-high and TH2/17-low asthma.

  • Fig. 4. Proportions of TH2/17 molecular phenotypes of asthma by clinical evidence of eosinophilia and severity.

    Asthmatics were classified on the basis of evidence of eosinophilic asthma, defined as blood eosinophil count ≥300/μl or sputum eosinophil percentage ≥3, or biopsy lamina propria eosinophil count ≥10/mm2 and clinical severity (British Thoracic Society/Scottish Intercollegiate Guidelines Network treatment step). Pie charts represent the proportion of TH2/17-low, TH2-high (TH2), and TH17-high (TH17) asthmatic subjects per eosinophilic/severity category. The area of each pie chart is proportional to the number of subjects in that category.

  • Fig. 5. Therapeutic blockade of TH2 cytokines during experimental allergic asthma induces compensatory TH17 inflammation.

    (A) Mice were intranasally (i.n.) sensitized against HDM extract for 3 weeks at 200, 100, and 100 μg each week and subsequently challenged with biweekly intranasal exposures for 4 weeks with or without targeted antibody therapy each day before challenge against IL-4, IL-13, or both cytokines [250 μg, intraperitoneally (I.P)]. (B and C) Lung pathology was assessed by scoring for gross inflammation in Giemsa-stained histological sections (B), assaying for hydroxyproline content as a surrogate for fibrosis (B), and Masson’s trichrome staining of airways (C). (D) Airway mucus production was assessed by periodic acid–Schiff (PAS) staining. (E and F) IL-13 (E) and IL-17 (F) production was measured by gene expression and in restimulated CD4 T cells by flow cytometry. The percent of eosinophils and neutrophils was quantified from Giemsa-stained histological lung sections. (F) Whole lung tissue expression of Clca3 and Ccl11 TH2 markers, and Cxcl3, Cxcl1, and Csf3 TH17 markers were assessed by qPCR (P values shown, two-tailed t tests, n = 4 to 10).

  • Fig. 6. Dual therapeutic blockade of IL-13 and IL-17 prevents emergence of a TH17 signature induced by antibody inhibition of the TH2 response.

    Mice on the chronic HDM model of allergic asthma were treated a day before each challenge with anti–IL-17, anti–IL-13, or both (150 μg). (A and B) Efficacy of IL-13/17 dual blockade was assessed by airway hyperreactivity [two-way analysis of variance (ANOVA), SEM shown, n = 5 to 10] (A) and mucus response gene expression (B). (C) Immune response was measured by gene expression analysis of IL-13 and IL-17, and flow cytometric analysis of the frequency of Siglec-F+ eosinophils and Ly6G+ neutrophils in bronchoalveolar lavage (BAL) (P values shown, two-tailed t tests, n = 5 to 28).

  • Murine primer sequences
    GeneForward qPCR
    primer sequence
    Reverse qPCR
    primer sequence
    Rplp2TACGTCGCCTCTTACCTGCTGACCTTGTTGAGCCGATCAT
    Il13CCTCTGACCCTTAAGGAGCTTATCGTTGCACAGGGGAGTCT
    CCL11GAATCACCAACAACAGATGCACATCCTGGACCCACTTCTTCTT
    Muc5acCAGGACTCTCTGAAATCGTACCAAAGGCTCGTACCACAGGGA
    Clca3AGGAAAACCCCAAGCAGTGGCACCGACGAACTTGATTTT
    Il17CAGACTACCTCAACCGTTCCAGCATCTTCTCGACCCTGAA
    Cxcl1CTGGGATTCACCTCAAGAACGAAGCCAGCGTTCACCAGAC
    Cxcl3CCCCAGGCTTCAGATAATCATCTGATTTAGAATGCAGGTCCTT
    Csf3GTGCTGCTGGAGCAGTTGTTCGGGATCCCCAGAGAGT
    IL4ACGAGGTCACAGGAGAAGGGAAGCCCTACAGACGAGCTCACTC

Supplementary Materials

  • www.sciencetranslationalmedicine.org/cgi/content/full/7/301/301ra129/DC1

    Fig. S1. Intercorrelation between the three IL-13–inducible genes and the five IL-17–inducible genes in endobronchial biopsies.

    Fig. S2. Neutrophilic inflammation in peripheral or airway compartments is not associated with molecular phenotypes of TH2 or TH17 inflammation.

    Fig. S3. Differential effects of TH2 blockade on mucous and inflammatory responses in allergic asthma.

    Fig. S4. Dexamethasone suppresses TH2 pathways but enhances TH17 pathways in the mouse asthma model.

    Fig. S5. Evidence of dual cross-regulation between the TH2 and TH17 cytokine networks.

    Fig. S6. A summary of the potential interplay between TH2 (IL-4/13)– and IL-17–dependent signaling in asthmatic airways.

    Table S1. Mutual exclusivity of IL-17 and IL-13 expression in endobronchial biopsies.

    Table S2. Clinical characteristics of TH2/17-low, TH2-high, and TH17-high asthma.

  • Supplementary Material for:

    TH2 and TH17 inflammatory pathways are reciprocally regulated in asthma

    David F. Choy, Kevin M. Hart, Lee A. Borthwick, Aarti Shikotra, Deepti R. Nagarkar, Salman Siddiqui, Guiquan Jia, Chandra M. Ohri, Emma Doran, Kevin M. Vannella, Claire A. Butler, Beverley Hargadon, Joshua C. Sciurba, Richard L. Gieseck, Robert W. Thompson, Sandra White, Alexander R. Abbas, Janet Jackman, Lawren C. Wu, Jackson G. Egen, Liam G. Heaney, Thirumalai R. Ramalingam, Joseph R. Arron,* Thomas A. Wynn, Peter Bradding

    *Corresponding author. E-mail: arron.joseph{at}gene.com

    Published 19 August 2015, Sci. Transl. Med. 7, 301ra129 (2015)
    DOI: 10.1126/scitranslmed.aab3142

    This PDF file includes:

    • Fig. S1. Intercorrelation between the three IL-13–inducible genes and the five IL-17–inducible genes in endobronchial biopsies.
    • Fig. S2. Neutrophilic inflammation in peripheral or airway compartments is not associated with molecular phenotypes of TH2 or TH17 inflammation.
    • Fig. S3. Differential effects of TH2 blockade on mucous and inflammatory responses in allergic asthma.
    • Fig. S4. Dexamethasone suppresses TH2 pathways but enhances TH17 pathways in the mouse asthma model.
    • Fig. S5. Evidence of dual cross-regulation between the TH2 and TH17 cytokine networks.
    • Fig. S6. A summary of the potential interplay between TH2 (IL-4/13)– and IL-17–dependent signaling in asthmatic airways.
    • Table S1. Mutual exclusivity of IL-17 and IL-13 expression in endobronchial biopsies.
    • Table S2. Clinical characteristics of TH2/17-low, TH2-high, and TH17-high asthma.

    [Download PDF]

Stay Connected to Science Translational Medicine

Navigate This Article