Research ArticleSystemic Lupus Erythematosus

Defective PTEN regulation contributes to B cell hyperresponsiveness in systemic lupus erythematosus

See allHide authors and affiliations

Science Translational Medicine  23 Jul 2014:
Vol. 6, Issue 246, pp. 246ra99
DOI: 10.1126/scitranslmed.3009131

Abstract

PTEN regulates normal signaling through the B cell receptor (BCR). In systemic lupus erythematosus (SLE), enhanced BCR signaling contributes to increased B cell activity, but the role of PTEN in human SLE has remained unclear. We performed fluorescence-activated cell sorting analysis in B cells from SLE patients and found that all SLE B cell subsets, except for memory B cells, showed decreased expression of PTEN compared with B cells from healthy controls. Moreover, the level of PTEN expression was inversely correlated with disease activity. We then explored the mechanisms governing PTEN regulation in SLE B cells. Notably, in normal but not SLE B cells, interleukin-21 (IL-21) induced PTEN expression and suppressed Akt phosphorylation induced by anti–immunoglobulin M and CD40L stimulation. However, this deficit was not primarily at the signaling or the transcriptional level, because IL-21–induced STAT3 (signal transducer and activator of transcription 3) phosphorylation was intact and IL-21 up-regulated PTEN mRNA in SLE B cells. Therefore, we examined the expression of candidate microRNAs (miRs) that could regulate PTEN: SLE B cells were found to express increased levels of miR-7, miR-21, and miR-22. These miRs down-regulated the expression of PTEN, and IL-21 stimulation increased the expression of miR-7 and miR-22 in both normal and SLE B cells. Indeed, a miR-7 antagomir corrected PTEN-related abnormalities in SLE B cells in a manner dependent on PTEN. Therefore, defective miR-7 regulation of PTEN contributes to B cell hyperresponsiveness in SLE and could be a new target of therapeutic intervention.

INTRODUCTION

Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by disturbed B cell homeostasis, which leads to autoantibody formation, immune complex deposition, or direct autoantibody deposition, with subsequent complement fixation, Fc receptor activation, and tissue inflammation (1). B cell homeostasis and function are controlled by cell surface receptor–ligand interactions. Signal transduction after receptor-ligand interactions involves a number of pathways, among which phosphatidylinositol 3-kinase (PI3K), a class IA molecule, plays a pivotal role by generating the lipid intermediate phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3]. The activation of PI3K is initiated by engagement of the pre–B cell receptor (BCR) and the BCR (26). Moreover, PI3K is essential for BCR activation and survival of all B cells in the mouse (6). Mammals express three class IA catalytic subunits of PI3K: p110α, p110β, and p110δ. p110δ is considered a promising target for inflammatory diseases because of its predominant expression in hematopoietic cells (7, 8). The p110δ isoform plays a central role in the response of B cells to antigen (9), and suppression of the PI3K signaling pathway inhibits the generation, activation, and persistence of self-reactive B cells (10).

The phosphatase and tensin homolog (PTEN) and SH2-containing inositol phosphatase-1 (SHIP-1) suppress the activity of the PI3K pathway (11). The SHIP proteins convert PI(3,4,5)P3 to PI(3,4)P2 (phosphatidylinositol 3,4-bisphosphate). PI(3,4)P2 appears to be of similar abundance to PI(3,4,5)P3 in most cell types and also plays a role as a second messenger with activities independent from PI(3,4,5)P3 (12). In contrast, PTEN acts as the major antagonist of the PI3K signaling pathway by dephosphorylating PI(3,4,5)P3 into PI(4,5)P2 (phosphatidylinositol 4,5-bisphosphate), which has no known second messenger function (11, 1317). PI(3,4,5)P3 contributes to cell signaling by recruiting the serine-threonine kinase Akt and facilitating its activation by exposing sites for phosphorylation by phosphatidylinositol-dependent kinase-1 (18). As a consequence, loss of PTEN function leads to excessive PI(3,4,5)P3 at the plasma membrane and to recruitment and activation of Akt family members that potently drive cell survival and proliferation (16, 1921).

The role of both SHIP-1 and PTEN in B cell activation and differentiation has been investigated using mice with a conditional deletion of either regulatory molecule in B cells. B cell–targeted deletion of SHIP-1 resulted in a severe lupus-like disease (22). Similarly, B cell–targeted deletion of PTEN resulted in sustained production of PI(3,4,5)P3 in mature B cells, failed tolerance induction, and abundant autoantibody production (23). Moreover, these mice displayed a substantial increase in the number of marginal zone (MZ) and B1 cells in the spleen, responded poorly to thymus-dependent and thymus-independent antigens, and were defective in immunoglobulin (Ig) class switch recombination (CSR) (23, 24). These results highlight the importance of regulation of the PI3K pathway in maintaining B cell tolerance and in the prevention of autoimmune disease.

Interleukin-21 (IL-21), produced mainly by activated CD4+ T cells, is an essential cytokine involved in the regulation of B cell responsiveness (2528). IL-21 overproduction was demonstrated in several murine lupus models, including the BX/SByaa mouse (29, 30) and the sanroque mouse strain (31). In addition, an IL-21 receptor (IL-21R)–Fc fusion protein significantly alleviated disease in MRL/lpr lupus-prone mice (32), and deletion of the IL-21R prevented autoimmune disease in the BX/SByaa mouse (29), suggesting that blocking IL-21 might be a potential therapeutic target in lupus patients. IL-21R is widely expressed by lymphohematopoietic cells and by keratinocytes and synovial fibroblasts (3341). In SLE patients, IL-21R was down-regulated in naïve and memory B cells and in plasmablasts compared to healthy controls (HCs) (33). Furthermore, lupus patients had higher concentrations of IL-21 in the plasma, although plasma IL-21 levels did not appear to correlate with lupus disease activity (42, 43). A role of IL-21 in regulating the activity of the PI3K pathway has not previously been demonstrated.

Most of the knowledge of PTEN and its potential role in autoimmunity has been derived from murine models. To determine whether PTEN plays a critical role in the immunodysregulation in patients with SLE, we compared the expression of PTEN in B cells from peripheral blood of newly diagnosed SLE patients and HCs. We found that SLE B cells showed decreased levels of PTEN, and the decrease was associated with increases in disease activity and severity, but not anti–double-stranded DNA (dsDNA) autoantibody titers in SLE patients. Regulation of PTEN by microRNAs (miRs) and the increased expression of these miRs by IL-21 were identified, and their role in altering B cell responsiveness in SLE was delineated. Together, these data provide insights into the mechanisms by which aberrant miR-mediated PTEN expression, regulation, and function contribute to B cell hyperresponsiveness in SLE.

RESULTS

PTEN expression by B cells was down-regulated in SLE patients

PTEN was expressed by all B cell populations examined in HCs (Fig. 1A). Compared to HCs, the expression of PTEN was diminished in SLE B cell subpopulations including IgD+CD38int/high immature B cells, IgD+CD38low/− naïve B cells, and IgDCD38int/high plasma cells (P < 0.001, Mann-Whitney test; n = 21) (Fig. 1, A and B, and table S1). In addition, PTEN mRNA was also decreased in SLE B cells (P = 0.03, Mann-Whitney test; n = 21) (Fig. 1C).

Fig. 1. Expression of PTEN by B cells in SLE patients compared with HCs.

(A) Flow cytometric analysis of the expression of PTEN by human B cell subpopulations defined by IgD and CD38 expression. Data from a representative HC (n = 9) and SLE patients (n = 21) are shown. MFI, mean fluorescence intensity. (B) Comparison of the expression of PTEN by B cell subpopulations in HC and SLE patients. (C) PTEN mRNA in total peripheral B cells of HC and SLE patients. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Data in (B) and (C) are presented as box plots; the box represents the 25th to 75th percentiles, the line within the box represents the 50th percentile, and the lines outside the box represent the minimum and maximum (HCs: n = 9; SLE: n = 21).

The expression of PTEN in SLE B cells correlated with disease activity and the level of proteinuria

The level of PTEN in CD19+ B cells was down-regulated in 76.7% (23 of 30) of SLE patients and tended to be inversely correlated with disease activity as determined by SLE disease activity index (SLEDAI) score (r2 = 0.24; P = 0.006, linear regression; n = 30; Fig. 2A) and also directly correlated with the serum C3 level, but not with the titer of anti-dsDNA autoantibodies (Fig. 2, B and C). Notably, PTEN reduction in CD19+ B cells was significantly decreased in SLE patients with nephritis manifested by proteinuria (P = 0.02, t test; n = 30; Fig. 2D), with greater decreases in PTEN expression noted in patients with more proteinuria.

Fig. 2. Relationship between PTEN expression by CD19+ B cells and clinical manifestations of SLE.

(A) SLEDAI score. (B) Anti-dsDNA antibody titer. (C) Serum C3 level. (D) Proteinuria. Data from 30 patients with SLE are shown.

Immature B cells in SLE patients exhibited greater activation and expansion

PTEN expression was markedly decreased in immature pre-naïve B cells. Therefore, we examined this population in greater detail. SLE patients had significantly higher proportions of CD19+IgD+CD38int/hi immature B cells than HCs (15.65 ± 2.26% versus 6.37 ± 1.04%) (P = 0.01, t test; n = 21; Fig. 3A), as reported previously (44, 45). These immature B cells in SLE patients expressed a greater density of activation markers as determined by mean fluorescence intensity, such as CD86 and CD95 (Fig. 3, B and C), compared to HCs (P = 0.006 and 0.005, respectively, t test; n = 21), suggesting that down-regulation of PTEN was associated with an increasing proportion of immature B cells and especially those with a more activated phenotype in SLE patients. Notably, naïve B cells also expressed lower levels of PTEN in SLE, and the PTENlow naïve B cells also exhibited increased expression of CD95 compared to normal naïve B cells (Fig. 3D).

Fig. 3. IgD+CD38int/hi B cells were expanded in SLE patients.

(A) Percentages of IgD+CD38int/hi B cells in total peripheral B cells from 9 HC subjects and 21 SLE patients. (B and C) Expression of CD86 and CD95 by IgD+CD38int/hi B cells. Data from a representative experiment performed on 9 HC subjects and 21 SLE patients are shown. (D) Expression of CD95 by IgD+CD38low/− naïve B cells. Data from a representative SLE patient (of 21 studied) and an HC (of 9 studied) are shown.

PTEN regulation in SLE B cells was impaired

IL-21 not only plays a major role in costimulating B cells but also has the capacity to induce death of B cells activated through the BCR (25). We therefore wondered whether IL-21 might alter BCR signaling by up-regulating PTEN expression. To test this hypothesis, we first examined the capacity of IL-21 to up-regulate PTEN expression in normal B cells.

We compared the capacity of IL-21 to induce PTEN expression with that of other cytokines that have been reported to contribute to regulating B cell function, including IL-2, IL-4, IL-6, and IL-10, and also studied the impact of CD40L and BCR engagement with anti–immunoglobulin M (IgM). We found that CD40L and anti-IgM were the most potent inducers of PTEN expression in normal B cells, followed by IL-21 and IL-2 (Fig. 4, A and B, and table S2). The capacity of IL-21 and the combination of CD40L and anti-IgM to up-regulate the expression of PTEN in CD19+ B cells was confirmed by Western blotting (Fig. 4C). Notably, the addition of IL-21 to B cells stimulated with anti-IgM and CD40L did not further up-regulate PTEN expression (Fig. 4B). Neither IL-21 alone, CD40L plus anti-IgM, nor the three in combination stimulated PTEN protein up-regulation in IgD+ B cells in SLE patients (Fig. 4, B and C). In contrast, PTEN mRNA level was up-regulated by IL-21 stimulation in both SLE and HC B cells (Fig. 4D), suggesting that IL-21–mediated PTEN induction in SLE was defective and might occur posttranscriptionally.

Fig. 4. IL-21–induced up-regulation of PTEN was defective in SLE patients.

(A) PTEN protein expression in normal B cells was assessed by flow cytometry after stimulation with various cytokines, CD40L, or anti-IgM for 72 hours. Data from a representative experiment of three are shown. (B) Peripheral blood B cells of HC and SLE patients were cultured with IL-21 alone, anti-IgM plus CD40L, or the three in combination and then collected at 72 hours, and the PTEN levels in IgD+ B cells were assessed by flow cytometry. ns, not significant. (C and D) Purified B cells from HC and SLE patients were stimulated with IL-21 or anti-IgM plus CD40L for 72 hours, respectively, and the PTEN protein levels were assessed by Western blot (C) and PTEN mRNA level was assessed using real-time polymerase chain reaction (PCR) (n = 5 per group) (D).

PTEN expression was regulated via induction of miRs stimulated by IL-21

Several miRs, including miR-21 and miR-22, have been demonstrated to down-regulate PTEN expression (4652). By TargetScan prediction, we identified that miR-7 could also potentially target PTEN as well (Fig. 5A). Using a dual-luciferase reporter gene assay, we found that miR-7 significantly inhibited the luciferase activity of a reporter construct containing the PTEN 3′ untranslated region (UTR) (Fig. 5B) (P = 0.01, t test; n = 3), indicating its capacity to down-regulate PTEN expression. We therefore examined the expression of all three of these miRs in B cells. We found the expression of miR-7, miR-21, and miR-22 in SLE B cells was significantly higher than that of HC B cells (P = 0.03, 0.0001, and 0.0001, respectively, t test; n = 15) (Fig. 5C). Moreover, IL-21 significantly up-regulated the expression of miR-7 and miR-22 in SLE B cells as well as in B cells from HCs (Fig. 5D). In contrast, the combination of anti-IgM plus CD40L did not induce miR-7 up-regulation, even though the combination strongly induced PTEN expression (fig. S1).

Fig. 5. Regulation of PTEN by miR-7.

(A) Bioinformatics prediction and alignment of miR-7 and PTEN. (B) Effect of miR-7 on PTEN expression determined by dual-luciferase report gene assay after transfection of CD19+ B cells. IL-10 was used as a negative control, and a designed complementary sequence of miR-7 was used as a positive control. (C) Real-time PCR analysis of miR-7, miR-21, and miR-22 expression in freshly isolated peripheral B cells from HC and SLE patients (means ± SD; HCs: n = 10, SLE: n = 15). (D) B cells from patients with SLE and from HCs were cultured with or without IL-21. Cells were collected at 72 hours; total RNA was extracted; and miR-7, miR-21, and miR-22 levels were assessed with real-time PCR (n = 4 per group). (E) Peripheral HC or SLE B cells were divided into three groups and electroporated with pre-miR-7, miR-7 antagomir, or control miR, respectively, after which real-time PCR was used to detect the expression levels of miR-7. (F) Flow cytometric detection of PTEN expression by HC or SLE B cells after electroporation with pre-miR-7 (upper panels), miR-7 antagomir (lower panels), or control miR and culture for 48 hours. The graphs on the right indicate staining of SLE B cells, and the graphs on the left indicate staining of HC B cells. (G) Flow cytometric detection of PTEN expression by SLE B cells after transfection with miR-7 antagomir (n = 5 per group).

To determine whether increased expression of miR-7 might contribute to the decreased expression of PTEN in SLE B cells, we electroporated peripheral B cells with pre-miR-7 or an miR-7 antagomir that resulted in overexpression of miR-7 or inhibition of the function of miR-7 (Fig. 5E). We found that overexpression of miR-7 reduced PTEN expression in HC B cells, and inhibition of miR-7 function increased PTEN levels in SLE B cells (Fig. 5F). To confirm this finding, another miR-7 antagomir or its negative control was transfected into SLE and HC B cells and then the expression of PTEN was measured by flow cytometry. The expression of PTEN in miR-7 antagomir–transfected SLE B cells was significantly up-regulated compared to that in negative control–transfected SLE B cells (P = 0.03, t test; n = 5) (Fig. 5G). These results indicate that miR-7, like miR-22, negatively regulates the level of PTEN in human B cells and that increased production of miR-7 in SLE B cells could contribute to impaired PTEN expression. We also found that B cells from NZB/NZW F1 mice expressed higher levels of miR-7, which is predicted to regulate murine PTEN expression, than did those from C57/BL6 mice (fig. S2). The abnormal increased miR-7 expression in SLE patients and in lupus mice suggests a potential role of miR-7 in the B cell hyperresponsiveness in both murine and human SLE.

Because IL-21 induced the expression of both PTEN and its negative regulator miR-7 in normal B cells, we assessed the time course of the expression of PTEN RNA and protein as well as miR-7 in normal B cells after stimulation with IL-21. As shown in fig. S3, we found that IL-21 induced miR-7 and PTEN mRNA levels within 12 hours of stimulation, whereas PTEN protein was not up-regulated at this time point. miR-7 reached a peak by 48 hours and afterward began to decline. This was accompanied by a further increase in PTEN mRNA and the up-regulation of PTEN protein expression. These data are consistent with a role of miR-7 in regulating PTEN expression.

Impaired PTEN regulation resulted in aberrant Akt phosphorylation and calcium signal transduction in B cells from SLE patients

IL-21 predominantly signals through the signal transducer and activator of transcription 3 (STAT3) pathway (28, 53). As previously reported, we found that IL-21 induced STAT3 phosphorylation in the presence or absence of CD40L plus anti-IgM stimulation (Fig. 6, A and B), whereas it reduced Akt phosphorylation stimulated by CD40L plus anti-IgM in HC B cells (Fig. 6, C and D). As expected from the lack of induction of PTEN by IL-21 in SLE B cells, IL-21 failed to suppress Akt phosphorylation induced by CD40L plus anti-IgM in lupus B cells (Fig. 6, C and D). Notably, however, IL-21 induced STAT3 phosphorylation in SLE B cells (Fig. 6A), suggesting that IL-21 signaling via engaging IL-21R was preserved in SLE B cells.

Fig. 6. Increased miR-7 expression resulted in aberrant Akt phosphorylation and calcium signal transduction in B cells from SLE patients.

B cells from HC and SLE patients were cultured with or without CD40L plus anti-IgM in the absence or presence of IL-21. (A to D) Phosphorylation of STAT3 (A and B) and Akt (C and D) was determined by intracellular staining at 5 min in peripheral B cells (HCs: n = 8, SLE: n = 6). (E) Baseline and anti-IgM–induced Ca2+ influx of freshly isolated B cells from HC and SLE B cells. Data from a representative experiment of six carried out are shown. (F) B cells from SLE patients and HCs were transfected with miR-7 antagomir or negative control and then examined for calcium flux upon BCR stimulation (n = 6). (G) Purified B cells from HCs were transfected with control siRNA or si-PTEN and cotransfected with miR-7 antagomir, miR-7 agomir, and negative control, respectively, for 72 hours, and the intracellular calcium levels were assessed by Fluo4-AM (n = 6). (H) Purified B cells from HCs were transfected with control siRNA or si-PTEN and stimulated with IL-21, anti-IgM plus CD40L, or the three in combination for 72 hours, after which the cells were collected and loaded with Fluo4-AM to assess the intracellular calcium levels of cells (n = 6). (I) Purified B cells from HCs were transfected with control siRNA or si-PTEN and stimulated with IL-21 for 72 hours, then stimulated with or without anti-IgM plus CD40L, and the phosphorylation of Akt was determined after 5 min by intracellular staining (n = 6).

The baseline [Ca2+]i was also measured, and there was a significant difference in the resting [Ca2+]i of SLE and HC B cells (P = 0.02, t test; n = 6) (Fig. 6E). In addition, anti-IgM induced higher [Ca2+]i responses in B cells from SLE patients than in those from HCs (P = 0.001, t test; n = 6) (Fig. 6E). Disruption of miR-7 activity with its antagomir in SLE B cells resulted in a significant (P = 0.0004, t test; n = 6) reduction of the calcium flux upon BCR stimulation to the level noted in HC B cells (Fig. 6F). To demonstrate that the impact of miR-7 on proximal BCR signaling was mediated by its action on PTEN expression, we knocked down PTEN expression using small interfering RNA (siRNA). Transfection of primary B cells with siRNA resulted in a substantial decrease in PTEN expression (fig. S4). As shown in Fig. 6 (G and H), the siRNA-mediated decrease in PTEN expression significantly increased the baseline calcium signal and blocked any further effect by the miR-7 agomir or antagomir. Moreover, the IL-21–mediated inhibition of the calcium signal and Akt phosphorylation induced by anti-IgM and CD40L was blocked by PTEN siRNA transfection (Fig. 6, H and I).

Abnormal miR-7/PTEN regulated IL-21 induction of plasma cell generation in SLE

IL-21 stimulation alone significantly (P = 0.003, t test; n = 23) reduced FOXO1 mRNA while significantly (P < 0.0001, t test; n = 23) increasing BLIMP1 mRNA in SLE B cells compared to HC B cells (Fig. 7A). Furthermore, IL-21 significantly increased the proportion of plasma cells measured as either CD19+CD27+CD38hi or CD138+CD38hi cells from SLE B cells in the absence of BCR signaling and T cell help (Fig. 7B and table S3). This effect of IL-21 in SLE could be reversed by the miR-7 antagomir, which up-regulated IL-21–induced PTEN in SLE B cells (Fig. 7C) but had no effect on IL-21–induced STAT3 phosphorylation (Fig. 7D and table S4).

Fig. 7. Abnormal miR-7/PTEN regulated IL-21 induction of plasma cell generation in SLE.

(A) Purified B cells from HC or SLE patients were cultured with or without IL-21. Cells were collected at day 3, and the expression of FOXO1 and BLIMP1 mRNA was detected by real-time PCR. Data are the mean of 23 experiments. (B) Purified B cells from HC or SLE patients were cultured with IL-2 (20 ng/ml) and IL-10 (20 ng/ml) with or without IL-21 stimulation for 5.5 days (n = 5 per group), after which cells were stained with anti-CD19, anti-CD27, anti-CD38, and anti-CD138 to detect plasmablasts/plasma cells that had differentiated. In addition, cells were stained for CD19 and PTEN expression. Data are representative of five carried out with similar results. (C) B cells from SLE patients were transfected with miR-7 antagomir or negative control and then cultured as described in (B). For phenotypic analysis, cells were harvested and incubated with mAb specific for CD27, CD38, and CD138. The expression levels of PTEN in the same cells were also detected by intracellular staining. Data shown are from one representative experiment of three carried out. (D) The B cells from HC and SLE patients were transfected with miR-7 agomir, antagomir, or negative control and were rested in culture. After 48 hours, the B cells were cultured alone or stimulated with IL-21 for 10 min, and the phosphorylation of STAT3 was examined by intracellular staining (HCs: n = 2; SLE: n = 4).

DISCUSSION

The aim of this study was to delineate the basis of B cell hyperactivity in subjects with SLE. This was advanced by examining B cells from patients with newly diagnosed untreated SLE to avoid changes that might result from disease chronicity or therapy. Because PTEN has been identified in the mouse as playing a central role in regulating B cell function and genetic deficiency of PTEN in murine B cells has been reported to result in the development of a lupus-like syndrome (23, 24), we focused on PTEN and its regulation in human SLE B cells. We were able to identify abnormalities in PTEN expression in SLE B cells that could promote B cell hyperactivity in this autoimmune disease. In addition, additional pathways of PTEN regulation by miRs and of the up-regulation of miR expression by IL-21 were identified that could further contribute to the increased responsiveness of SLE B cells.

PI3K activity plays a central role in B cell activation, especially after signaling through the BCR. PI3K signaling is important in regulating the survival of both mature and immature B cells, and PI3K-mediated phosphorylation of Akt, which is downstream of BCR engagement, is necessary for BCR signaling (4, 6, 9, 19). PI3K can be directly antagonized by PTEN, which is generally active and present in both resting and activated B cells (54). Both transgenic expression of constitutively active PI3K and selective knockout of PTEN result in increased survival of B cells (6, 55).

Mice with PTEN-deleted B cells have enlarged MZs and an expanded B1 B cell compartment, have elevated serum levels of autoantibodies, and manifest a “hyper-IgM”–like syndrome (23, 24). Conversely, most defects in peripheral B cell differentiation in mice lacking the PI3K adaptor CD19 were corrected by simultaneous deletion of PTEN (24). Inactivation of PTEN can overcome the loss of CD19 and restore the MZ B and B1 compartments and germinal center B cell formation. These findings collectively support the pivotal role of PTEN in PI(3,4,5)P3-mediated regulation of the differentiation of peripheral B cell subsets. Uncontrolled PI(3,4,5)P3 production directly contributed to tolerogenic signaling because PTEN deletion resulted in failed B cell anergy and enhanced responsiveness to BCR signaling in newly formed B cells (6). Therefore, the magnitude and duration of PI3K-dependent signaling and its role in governing B cell growth, survival, and differentiation were tightly regulated by PTEN.

Our study demonstrated that the level of PTEN was significantly down-regulated in SLE B cells, especially in immature and naïve B cells, and the proportion of the immature B cell subset was significantly increased. Clinically, the expression of PTEN in SLE B cells was inversely correlated with the SLEDAI score and also directly correlated with the serum C3 level, implying a relationship to disease activity. Finally, the relationship to proteinuria indicated a role for PTEN in contributing to disease severity.

Immature (CD19+IgD+CD38int/hi) B cells have autoreactive potential but are kept anergic in normal subjects (44, 45). Under certain pathological circumstances, they can be inappropriately activated, and an increase in number or activation status of this population may contribute to the immunopathogenesis of SLE (45). Therefore, low expression of PTEN in immature B cells may have an important role in regulating the growth, survival, and differentiation of this B cell subset, and defective PTEN may result in failed B cell anergy, allow expansion or survival of the immature population, and contribute to the development of autoimmunity. The current finding that these cells increase in number and manifest an activated phenotype associated with decreased PTEN expression is consistent with this conclusion.

We also found that IL-21 stimulated PTEN expression while it inhibited Akt phosphorylation in normal B cells, implying an important role for IL-21 in regulating B cell responsiveness to BCR engagement. This finding is consistent with previous reports of IL-21 inhibiting the responsiveness of murine and human B cells stimulated by BCR engagement only (56, 57). In SLE B cells, IL-21 phosphorylation of STAT3 was intact, as was the induction of PTEN mRNA. However, IL-21 failed to up-regulate PTEN protein and inhibit Akt phosphorylation in activated B cells. This implied a defect in IL-21–mediated regulation of B cells activated through the BCR that could contribute to lupus pathogenesis.

The nature of the abnormal regulation of PTEN suggested a defect in posttranscriptional regulation of this molecule. Abnormal miR expression was found to contribute to this defective regulation of PTEN, because we found that the expression of miR-7, miR-21, and miR-22 was increased in SLE B cells when compared to B cells from healthy subjects. In addition to the previously reported finding that PTEN is down-regulated by miR-21 and miR-22 (4652, 58), we also demonstrated that PTEN was down-regulated by miR-7 because PTEN expression was markedly increased when miR-7 was antagonized in lupus B cells and decreased when miR-7 was overexpressed in HC B cells. Moreover, IL-21 stimulation could up-regulate miR-7 and miR-22 in B cells of both SLE patients and HCs in vitro (Fig. 5D), implying that regulation of these two miRs might be central to the process of IL-21–mediated PTEN expression and modulation of B cell function. miR-7 is known to regulate a number of downstream targets in the PI3K pathway, including mammalian target of rapamycin (mTOR) and p70 S6 kinase (59), but has not previously been shown to directly regulate expression of PTEN. Moreover, a role for IL-21 in regulating expression of miR-7 has also not been shown, although this effect is plausible because miR-7 is regulated by cMyc (60) and IL-21 is known to up-regulate cMyc in B lineage cells (61). The effect of IL-21 on miR-22 expression may be more indirect because the transcriptional regulation of this miR does not appear to involve promoter elements downstream of IL-21 signaling (48). However, miR-22 is up-regulated by activated Akt (48) and therefore could be downstream of IL-21–induced miR-7 up-regulation, resultant decreased expression of PTEN, and enhanced Akt signaling. Such a mechanism of miR-22 expression would be consistent with the apparent dominance of miR-7 in regulating SLE B cell signaling and activation noted here, but would require additional experimental verification.

The abnormal expression of miR-7, miR-21, and miR-22 in SLE B cells could be a primary epigenetic defect or secondary to a variety of activation signals that up-regulate these miRs, including but perhaps not limited to IL-21. It is unlikely that increased levels of IL-21 in SLE patients alone can explain the abnormal expression of these miRs, because we found that miR-21 was also up-regulated in SLE B cells, but we did not observe miR-21 to be up-regulated by IL-21 stimulation in vitro. It remains possible that the abnormal levels of these miRs are secondary to the activation status of SLE B cells and not primary abnormalities. Regardless, we can conclude that these defects are found in the vast majority of patients with early untreated SLE studied here, and primary or secondary changes in miR levels can have profound effects on B cell function.

PTEN regulates BCR-coupled proximal signaling and cellular activation by inhibiting the PI3K pathway in both mature and immature B cells (6, 55, 62). Although the initial Ca2+ signal is directly induced by a phospholipase C-γ–dependent inositol 1,4,5-trisphosphate–mediated mechanism, PI(3,4,5)P3 plays a critical amplifying role (63), and alterations in PTEN greatly affect the initial Ca2+ signal (64). Moreover, the initial Ca2+ signal plays a critical role in BCR-mediated activation and cell fate decisions of B cells (65). Our study demonstrated that the baseline Ca2+ influx was increased in SLE B cells. This likely reflects increased in vivo activation. Moreover, in vitro anti-IgM engagement induced significantly higher Ca2+ influx in SLE B cells than in HC B cells. The increased calcium signals were significantly blocked by the miR-7 antagomir in SLE B cells, which also increased PTEN. These results are consistent with the conclusion that abnormally depressed PTEN levels in SLE B cells favor enhanced BCR-mediated activation both in vivo, as evidenced by increased baseline Ca2+ levels, and in vitro, as manifested by increased Ca2+ influx after BCR engagement. The finding that siRNA-mediated knockdown of PTEN mimicked the effects of miR-7 overexpression and blocked the action of miR-7 manipulation argues strongly that the major effect of miR-7 in these events devolves from its capacity to regulate PTEN. Together, the results strongly indicate that the abnormal miR-7 regulation of PTEN reported here contributes to BCR-mediated activation of SLE B cells.

It is also notable that SLE B cells manifested distinctly abnormal responses to IL-21. Whereas normal murine and human B cells respond to stimulation by IL-21 alone by undergoing cell death (30, 56, 66, 67), SLE B cells were induced to undergo differentiation into plasma cells by IL-21 stimulation alone. This involved a miR-7/PTEN–mediated mechanism because the antagomir of miR-7 increased PTEN levels and reduced IL-21–mediated plasma cell differentiation of SLE B cells. Notably, the miR-7 antagomir did not alter IL-21–induced STAT3 phosphorylation, suggesting that IL-21 signaling was not altered by the activity of miR-7, as would be expected. Rather, the data are most consistent with a two-step model of B cell activation in SLE, in which the B cells have received a signal through the BCR in vivo, rendering them hyperresponsive to IL-21 signaling. The antagomir of miR-7 might then permit increased PTEN expression and thereby dampen BCR signaling and reduce the responsiveness to IL-21.

When we compared our finding in SLE patients with data from B cell conditional PTENflox/flox mice (24), it was intriguing to find that they shared many characteristics, including a high percentage of immature B cells with a more activated phenotype, and an increase in CD38-expressing plasma cells. These data collectively indicated that PI3K/PTEN/Akt might contribute to B cell overreactivity in SLE. Defective regulation of PTEN by specific miRs in SLE may explain the abnormal B cell homeostasis in this condition with expanded and activated immature B cells and also expanded plasma cells, both of which normally express the greatest levels of PTEN and are significantly increased in SLE.

The expression of PTEN and miR-7 was identified immediately ex vivo and therefore was likely to reflect in vivo B cell biology accurately. Moreover, all of the analyses were carried out with cells from newly diagnosed untreated patients, and thus many of the confounders, such as disease duration and therapy, were avoided. However, one deficiency of this study was that analysis of the role of B cell miR-7 in regulating PTEN expression was carried out in vitro and in the absence of many of the regulatory influences that might affect this complex biology in vivo. The results, although informative, must therefore be considered preliminary until the full biology of the described phenomena can be assessed in vivo. In addition, a number of miRs have been shown to regulate PTEN expression (4652). Although we focused on miR-7, it is possible that other miRs become dominant when B cells undergo activation and differentiation. Moreover, because the amounts of various mRNAs with 3′UTRs capable of binding miR-7 may change as B cells become activated and undergo differentiation, it is possible that the influence of miR-7 on PTEN expression could become less. This could be particularly important for miR-7 regulation of PTEN because the seed sequence between the miR and the 3′UTR of PTEN is only modestly homologous. Additional in vivo experiments will be required to test the hypotheses generated by the current work.

In summary, the data have established a mechanism contributing to B cell overactivity in SLE. Increased expression of several miRs, including miR-21, miR-22, and miR-7, can result in defective expression of PTEN and enhanced BCR signaling. Notably, two of the miRs, miR-7 and miR-22, are regulated by IL-21 and appear to provide a positive feed-forward loop in normal B cells by down-regulating PTEN expression that can enhance BCR signaling. This can be mitigated by the subsequent capacity of IL-21 to enhance PTEN expression, making the interplay between BCR and IL-21 signaling quite complex. The decrease in PTEN expression in SLE B cells and their heightened responsiveness can be reversed by an antagomir of miR-7, pointing to this miR as playing a dominant role in the hyperactivity of SLE B cells. Therefore, decreased expression of PTEN regulated by miR-7, and perhaps miR-21 and miR-22, contributes to B cell hyperresponsiveness and disturbed B cell homeostasis in SLE.

MATERIALS AND METHODS

Study design

We mainly used B cells from peripheral blood of newly diagnosed untreated SLE patients (versus HCs) to determine whether PTEN plays a critical role in the immunodysregulation in patients with SLE. PTEN protein and mRNA expressions by SLE B cells immediately ex vivo were examined and correlated with clinical manifestations. Then, the capacity of IL-21 in the presence or absence of CD40L and BCR engagement with anti-IgM to induce PTEN protein/mRNA expression, Akt, and/or STAT3 phosphorylation was examined in vitro and compared between SLE and HC B cells. Next, the expression of candidate miRs that could regulate PTEN was identified by TargetScan prediction and confirmed using a dual luciferase reporter gene assay with a reporter construct containing the PTEN 3′UTR. The abnormal expressions of these miRs in SLE B cells and their regulation by IL-21 and anti-IgM plus CD40L were also verified. To determine whether the abnormal expression of PTEN and its regulation by these miRs contribute to B cells function in SLE, we electroporated peripheral B cells with pre-miR or an miR antagomir in the presence or absence of si-PTEN and examined Akt and/or STAT3 phosphorylation and calcium signal transduction in B cells as well as the induction of plasma cell generation in SLE. All experiments were repeated at least three times.

Patients and controls

Peripheral blood samples from 60 new-onset treatment-naïve SLE patients (56 female, 4 male; mean age, 23 years; range, 14 to 42 years) were collected at Peking Union Medical College Hospital. All patients fulfilled the revised American College of Rheumatology criteria for SLE. SLEDAI 2000 criteria were used to evaluate disease activity (mean, 12.6; range, 4 to 28). Peripheral blood samples from 58 HC subjects (54 female, 4 male; mean age, 27 years; range, 20 to 32 years) were also collected as controls.

Peripheral blood mononuclear cell isolation, cell purification, and culture

Human peripheral blood mononuclear cells (PBMCs) were collected into sodium heparin tubes (BD) and purified by Ficoll-Hypaque density gradient centrifugation. Peripheral B cells were isolated with a negative isolation kit (Miltenyi Biotec). The purity of the CD19+ population was typically >95%. Purified B cells were stained with anti-IgD–fluorescein isothiocyanate (FITC) monoclonal antibody (mAb) (eBioscience) for 30 min on ice in staining buffer [1% bovine serum albumin (BSA) in phosphate-buffered saline (PBS)]. The IgD+ B cells were positively selected using anti-FITC microbeads (Miltenyi Biotec). Isolated IgD+ B cells were routinely ≥90% pure. PBMCs or purified B cells (1 × 106 cells/ml) were incubated with human recombinant IL-2 (rIL-2) (100 U/ml; R&D Systems), rIL-4 (10 ng/ml; PeproTech), rIL-6 (4 ng/ml; PeproTech), rIL-10 (25 ng/ml; PeproTech), rIL-21 (50 ng/ml; R&D Systems), rCD40L (20 ng/ml; PeproTech), or anti-IgM (10 μg/ml; eBioscience) alone or in combination.

Flow cytometric analysis

PBMCs or peripheral B cells were stained with various combinations of mAb for 30 min on ice in staining buffer (1% BSA in PBS). The directly conjugated mAbs used were anti-CD19–FITC (BD), anti-IgD–PE (phycoerythrin) (BD), anti-CD38–PECY7 (BD), anti-CD86–APC (allophycocyanin) (BD), anti-CD95–APC (eBioscience), anti–IL-21R–APC (BioLegend), anti-CD138–FITC (BD), and anti-CD27–FITC (BD). For simultaneous detection of intracellular PTEN expression, cells were first stained for the above-mentioned surface molecules before fixation and permeabilization with BD Cytofix/Cytoperm solution. Cells were then washed in 0.05% saponin before being stained with anti-human PTEN–Alexa Fluor 647–conjugated mAb (BD Phosflow). Stained cells were washed and then analyzed immediately using four-color Flow Cytometer C6 (Accuri Cytometers)/FACSAria II (BD) or fixed in 1% paraformaldehyde and analyzed within 24 hours. The data were analyzed with CFlow/FlowJo software.

Western blotting

For detection of intracellular PTEN expression, purified B cells (2 × 106 cells/ml) were incubated with human rIL-21 (50 ng/ml) and anti-IgM (10 μg/ml) plus rCD40L (20 ng/ml), respectively. After cultured for 72 hours, Western blotting was used to detect the expression of PTEN protein. Briefly, cultured B cells were washed with PBS, and protein was extracted with lysis buffer (pretreated with protease inhibitors). The protein concentrations were determined with the BCA Protein Assay Kit (Beijing Tianlai Biotech. Co.). Each cell lysate containing 50 μg of protein was fractionated by 12% SDS–polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane. The membrane was blocked with tris-buffered saline–Tween 20 (TBST) containing 5% nonfat milk for 1 hour at room temperature followed by incubation overnight with human anti-PTEN mAb (Cell Signaling Technology) at 4°C. The membrane was washed three times and incubated with secondary antibody (Zhongshan Goldenbridge Biotech. Co.) for 1 hour at room temperature. Enhanced chemiluminescence reagent was added after washing the membrane three times. Immunoreactive protein was detected by chemiluminescence with Kodak X-AR film.

Real-time quantitative PCR

Purified B cells freshly isolated or cultured were harvested and resuspended in TRIzol (Invitrogen Life Technologies) and stored at −70°C. Total RNA was extracted using the RNeasy Mini Kit (Qiagen). Reverse transcription reactions were prepared using the SYBR Premix Ex Taq System (Takara). Real-time PCR was performed using the IQ5 System (Bio-Rad), and cycle conditions and relative quantification were completed following the manufacturer’s instructions (Bio-Rad). Expression of PTEN, FOXO1, and BLIMP1 was calculated using the comparative computerized tomography method with efficiency calculations and with all mRNA levels normalized to GAPDH mRNA. All reported values were then further normalized to control conditions of peripheral B cell cultures with no cytokine or antibody treatment.

Cells were harvested and resuspended in TRIzol (Invitrogen), and total RNA was extracted using the miRNeasy Mini Kit (Qiagen). Reverse transcription reactions were prepared using the miScript Reverse Transcription Kit (Qiagen). Real-time PCR was performed using the LightCycler 480II system (Roche), and cycle conditions and relative quantification were completed as described by the manufacturer’s instructions (Roche). MiScript primers (Qiagen), designed to amplify specifically mature miR, were as follows: hsa-miR-7, hsa-miR-21, and hsa-miR-22. The expression levels were normalized to small nuclear RNA U6. Relative expression levels were calculated using the 2−ΔΔCt method.

Dual-luciferase reporter assay

To investigate whether PTEN expression could be regulated by miR-7, a dual-luciferase reporter assay was performed. IL-10 was used as a negative control, and a designed complementary sequence of miR-7 was used as a positive control [restriction sites: Xba I (5-TCTAGA-3) and Not I (5′-GCGGCCGC-3′); upstream: 5′-TCTAGAACCTTCTGATCACTAAAACAACAACCTTCTGATCACTAAAACAACAACCTTCTGATCACTAAAACAACAACCTTCTGATCACTAAAACAACAACCTTCTGATCACTAAAACAACAGCGGCCGC-3′; downstream: 5′-GCGGCCGCTGTTGTTTTAGTGATCAGAAGGTTGTTGTTTTAGTGATCAGAAGGTTGTTGTTTTAGTGATCAGAAGGTTGTTGTTTTAGTGATCAGAAGGTTGTTGTTTTAGTGATCAGAAGGTTCTAGA-3′]. The 3′UTRs of PTEN and IL-10 were amplified by PCR. Amplification of the 3′UTR of PTEN used the following primers: 5′-TCTAGACAGTGCTAAAATTC-3′ (forward) and 5′-GCGGCCGCTATATATCAATG-3′ (reverse). Amplification of the 3′UTR of IL-10 used the following primer sequences: 5′-TCTAGAGCCAGCTACCCCCTACC-3′ (forward) and 5′-GCGGCCGCTGGGTCCAGCCCTGTT-3′ (reverse). After restricted digestion, amplified DNA segments were cloned into the corresponding sites of the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega). The recombined pmirGLO vector was cotransfected with 3 pmol of Pre-miR miR-7 Precursor or Pre-miR miRNA Precursor Negative Control into 293T cells (2 × 104 per well, 96-well plate) with Lipofectamine 2000 (Invitrogen). Cells were harvested 30 hours later and analyzed by the Dual-Glo Luciferase Assay System (Promega). All transfection experiments were conducted in triplicate.

Electroporation and tranfection

Purified B cells were pelleted and resuspended in Nucleofector Solution at room temperature at a concentration of 5.0 × 106 cells per 100 μl. Pre-miR miR-7 Precursor (Ambion), Pre-miR miRNA Precursor Negative Control (Ambion), miR-antagomir (Anti-miR miR-7 Inhibitor, Ambion), or Anti-miR miRNA Inhibitor Negative Control (Ambion) and, in some experiments, a cocktail of 300 pmol siRNA (RiboBio) targeting PTEN mRNA were added to 100 μl of cell suspension and then transferred into an Amaxa nucleofection cuvette (Lonza). Cells were electroporated and then rinsed with ~500 μl of the preequilibrated culture medium and transferred to a sterile 12-well plate.

Human micrOFF hsa-miR-7-5p (MIMAT0000252) antagomir, micrON hsa-miR-7-5p agomir, and micrOFF antagomir Negative Control #24 were purchased from RiboBio. Cells at a concentration of 1 × 106 cells/ml were seeded in plates. Human hsa-miR-7-5p (MIMAT0000252) antagomir, agomir, or negative control was directly transfected into B cells at a final concentration of 200 nM, according to the manufacturer’s protocol.

Expression of phospho-Akt and phospho-STAT3

Freshly isolated human peripheral B cells were first cultured in complete RPMI 1640 medium without fetal bovine serum for at least 1 hour or, in some experiments, first transfected with human hsa-miR-7-5p antagomir, agomir, or their negative control; transfected with control siRNA or si-PTEN as indicated; and then stimulated with rIL-21 (50 ng/ml; R&D Systems) in the absence or presence of rCD40L (20 ng/ml; PeproTech) plus anti–human IgM (10 μg/ml; eBioscience) for 5 to 10 min. Expression of phospho-STAT3 and phospho-Akt was then determined after fixation, permeabilization, and labeling with specific mAbs (BD Phosflow).

Ca2+ influx measurement

[Ca2+]i was measured by means of the calcium indicator Fluo4-AM (acetoxymethyl ester) (Invitrogen). Briefly, freshly isolated B cells or B cells that had been transfected with human hsa-miR-7-5p antagomir, agomir, and its negative control, respectively, or that had been transfected with control siRNA or si-PTEN and then stimulated with or without IL-21, anti-IgM plus CD40L, or the three in combination at the time indicated, were suspended in Ringer’s solution and left to recover for 10 min and loaded with 2.5 μM Fluo4-AM (Invitrogen). After incubation, cells were washed twice and analyzed by flow cytometry (BD FACSAria II) to record the intracellular Ca2+. In some cases, the resting Ca2+ levels were analyzed for 2.5 min, after which B cells were stimulated with anti-IgM (10 μg/ml), and the resulting Ca2+ influx was recorded for 10 min. Afterward, ionomycin (1 μg/ml) (Sigma-Aldrich) was added to elicit the maximum response over the last 4 min in all assays. Data were analyzed by fluorescence-activated cell sorting analysis software FlowJo 7.6 (Tree Star).

Statistical analysis

All data were analyzed using SPSS 16.0 software. The data that passed both Kolmogorov-Smirnov and Shapiro-Wilk tests (P > 0.05) were considered to be a normal distribution. For data with normal distribution and homogeneity of variance (means and SDs), one-way analysis of variance with adjusted Bonferroni correction was used to assess the differences among groups. An independent-sample t test and a paired-sample t test were used to compare differences between two groups and differences before and after treatment. Correlation was calculated with Pearson’s correlation. For data with nonnormal distribution, the Mann-Whitney test was used to compare differences between two groups, and correlation was analyzed with Spearman’s rank order test. Values of P < 0.05 were considered statistically significant.

SUPPLEMENTARY MATERIALS

www.sciencetranslationalmedicine.org/cgi/content/full/6/246/246ra99/DC1

Fig. S1. Unlike IL-21, anti-IgM plus CD40L did not induce miR-7 up-regulation.

Fig. S2. B cells from NZB/NZW F1 lupus mice expressed high levels of miR-7.

Fig. S3. Time course of the expression of PTEN RNA and protein as well as miR-7 expression in HC B cells after stimulation with IL-21.

Fig. S4. si-PTEN transfection knocked down PTEN expression in B cells.

Fig. S5. Gating controls for flow cytometry experiments.

Table S1. Raw data for Fig. 1.

Table S2. Raw data for Fig. 4A.

Table S3. Raw data for Fig. 7B.

Table S4. Raw data for Fig. 7C.

REFERENCES AND NOTES

  1. Acknowledgments: We thank the health professional staff from the Department of Rheumatology and Clinical Immunology, Peking Union Medical College Hospital, and the patients for their participation in this study. Funding: Supported by grants from the National Natural Science Foundation of China (81325019, 81172859, 81273312, and 81302594), the Beijing Municipal Natural Science Foundation (7141008 and 7144208), the National Major Scientific and Technological Special Project (2012ZX09303006-002), the Research Special Fund for Public Welfare Industry of Health (20120217 and 201302017), the Capital Health Research and Development of Special Fund (2011-4001-02), and the National Laboratory Special Fund (2060204). Author contributions: X.Z. and P.E.L. designed the study. All authors analyzed the results and wrote the manuscript. Flow cytometry experiments were performed by X.-n.W., Y.-x.Y., and J.-w.N. H.C., L.-d.Z., X.-f.Z., F.-c.Z., and F.-l.T. participated in sample collection and clinical analysis. Y.L., X.L., X.Y., W.H., and X.-t.C. participated in real-time PCR, Western blot, calcium influx experiments, cell culture and transfection, and animal experiments. Competing interests: The authors declare that they have no competing interests.
View Abstract

Stay Connected to Science Translational Medicine

Navigate This Article