Research ArticleCancer

Interfering with Resistance to Smoothened Antagonists by Inhibition of the PI3K Pathway in Medulloblastoma

See allHide authors and affiliations

Science Translational Medicine  29 Sep 2010:
Vol. 2, Issue 51, pp. 51ra70
DOI: 10.1126/scitranslmed.3001599

Abstract

The malignant brain cancer medulloblastoma is characterized by mutations in Hedgehog (Hh) signaling pathway genes, which lead to constitutive activation of the G protein (heterotrimeric guanosine triphosphate–binding protein)–coupled receptor Smoothened (Smo). The Smo antagonist NVP-LDE225 inhibits Hh signaling and induces tumor regression in animal models of medulloblastoma. However, evidence of resistance was observed during the course of treatment. Molecular analysis of resistant tumors revealed several resistance mechanisms. We noted chromosomal amplification of Gli2, a downstream effector of Hh signaling, and, more rarely, point mutations in Smo that led to reactivated Hh signaling and restored tumor growth. Analysis of pathway gene expression signatures also, unexpectedly, identified up-regulation of phosphatidylinositol 3-kinase (PI3K) signaling in resistant tumors as another potential mechanism of resistance. Probing the relevance of increased PI3K signaling, we demonstrated that addition of the PI3K inhibitor NVP-BKM120 or the dual PI3K-mTOR (mammalian target of rapamycin) inhibitor NVP-BEZ235 to the initial treatment with the Smo antagonist markedly delayed the development of resistance. Our findings may be useful in informing treatment strategies for medulloblastoma.

Introduction

The Hedgehog (Hh) pathway is critical for the development and homeostasis of many organs and tissues. In the resting state, the Hh receptor Patched (Ptch) inhibits the activity of Smoothened (Smo), a G protein (heterotrimeric guanosine triphosphate–binding protein)–coupled receptor (GPCR)–like molecule. Upon Hh ligand binding, Ptch inhibition is attenuated, and Smo signals via a cytosolic complex of proteins to activate the Gli family of transcription factors (1). Gli1 and Gli2 are responsible for most of this transcriptional activation, whereas Gli3 acts mainly as a repressor. Gli1 is a direct transcriptional target of Hh signaling and a marker for pathway activity. Loss-of-function mutations in Ptch or gain-of-function mutations in Smo, which lead to ligand-independent pathway activation of Smo, have been identified in medulloblastoma and basal cell carcinoma (2). Mice with a heterozygous deletion of Ptch develop medulloblastomas that are highly responsive to inhibition by Smo antagonists (3), strongly suggesting that these tumors are “addicted” to Smo activity. The extent of tumor cell addiction to oncogenic pathways can be most robustly revealed by understanding the mechanisms of emergent resistance after treatment of genetically defined cancers with targeted therapeutics (4). To understand the key oncogenic mechanisms operant when Ptch is inhibited, we have explored mechanisms of resistance to Smo inhibitors using NVP-LDE225, a Smo antagonist currently in clinical development (5).

Results

Emergence of resistance to Smo inhibition

NVP-LDE225 is a potent and selective oral Smo antagonist from a newly described structural class (fig. S1) (5). This molecule displaces the binding of the synthetic Smo agonist Hh-Ag 1.5 (6) to human and mouse Smo with an IC50 (half-maximal inhibitory concentration) of 11 and 12 nM, respectively, and, at low nanomolar concentrations, inhibits Hh signaling in human and mouse cells (table S1) (5). In medulloblastoma tumors derived from Ptch+/−p53−/− mice (7) and implanted subcutaneously into nude mice, expression of the Hh pathway target gene Gli1 was completely suppressed by oral administration of NVP-LDE225 [20 mg/kg per day, once per day (qd)] (Fig. 1A). Consistent with the dose response for suppression of Gli1 messenger RNA (mRNA) (5), treatment of tumor-bearing mice with NVP-LDE225 induced partial growth inhibition at 10 mg/kg per day and near-complete regression (84 to 92%) beginning at doses of 20 mg/kg per day (Fig. 1B). However, on day 13 of continuous dosing of NVP-LDE225, tumor regrowth was observed in all treatment groups and for all tumors, indicating the development of resistance. Resistant tumors had a more heterogeneous histological appearance than did drug-sensitive tumors (fig. S2). The development of resistance was also seen in mice treated with HhAntag (Fig. 1B), a Smo antagonist from a structurally distinct class (8).

Fig. 1

Antagonism of Smo inhibits Hh signaling and growth of Ptch+/−p53−/− tumors but induces resistance. Nude mice subcutaneously implanted with medulloblastoma tumors were treated with vehicle (control) or NVP-LDE225 (black symbols) or HhAntag (black and white squares) at different doses [indicated in mg/kg per day qd or split in two doses (bid)]. (A) Gli1 mRNA levels in tumors quantified at day 3 (black) or when tumor size limit was reached (gray; vehicle control: day 11 or NVP-LDE225: day 26) under continuous treatment, normalized to β-actin, and blotted as percent of matching vehicle for the respective study. (B) Tumor volume over time. Data are expressed as means ± SEM (n = 8). (C) NVP-LDE225 inhibits proliferation of sensitive tumors (filled circles) but not of resistant tumor cells ex vivo (filled triangles) at low nanomolar concentration, as measured in vitro by [3H]thymidine uptake. Data are expressed as means ± SD (n = 3). Results are shown for one sensitive and one resistant tumor, but similar results were obtained for several different tumors.

Although complete suppression of Gli1 mRNA in response to initial NVP-LDE225 treatment was seen, reexpression of Gli1 mRNA was observed in resistant tumors (Fig. 1A). A similar pattern of reexpression in resistant tumors was observed for several Hh pathway target genes such as Ptch1, Ptch2, and CyclinD1 (2) (fig. S3). These data show that resistance to Smo inhibition is associated with reactivation of Hh signaling. Whether this reactivation occurs in all tumor cells or in a subset remains to be addressed.

To determine whether resistance and Gli1 reactivation were unique to the Ptch+/−p53−/− mouse model, we carried out similar experiments with allografts derived from Ptch+/−Hic1+/− mice (9). Hypermethylated in cancer 1 (Hic1) is a frequent target of epigenetic gene silencing in medulloblastoma (9). In the context of a Ptch+/− background, heterozygous deletion of Hic1 leads to the development of Hh pathway–dependent medulloblastoma. Thus, we implanted nude mice subcutaneously with medulloblastomas derived from Ptch+/−Hic1+/− mice and then treated the mice with NVP-LDE225 orally at similar doses and schedules as in the previous experiment. We observed pronounced inhibition of Gli1, Ptch1, Ptch2, and CyclinD1 mRNA expression (figs. S4A and S5) and tumor regression (fig. S4B) during the initial treatment, followed by regrowth of some tumors (table S2) that showed restoration of a variable degree of Hh pathway target gene expression (figs. S4A and S5). Similar observations were made in the Ptch+/− allograft model. The rapid emergence of resistance to NVP-LDE225 with restoration of Hh pathway target gene expression in both models is consistent with a marked addiction to Hh signaling in Ptch+/− medulloblastoma. The development of resistance appeared less pronounced in the Ptch+/−Hic1+/− and Ptch+/− allograft models compared to the Ptch+/−p53−/− allograft model, but larger studies would be required to draw a statistically significant conclusion.

To confirm that NVP-LDE225 resistance resulted from a cell-autonomous rather than an extrinsic mechanism such as decreased drug exposure, we measured the ex vivo proliferation (10) of tumor cells freshly isolated from sensitive (pretreatment) and resistant tumors in response to NVP-LDE225. Whereas growth of sensitive medulloblastoma cells was robustly inhibited (IC50 6 nM), growth of resistant tumor cells was largely unaffected by exposure to NVP-LDE225 (IC50 >20 μM) (Fig. 1C) or to other Smo antagonists such as HhAntag and cyclopamine (table S3). Together, these data suggested that cell-autonomous mechanisms caused resistance to Smo inhibition in these tumors.

Reactivation of Hh signaling in resistant tumors

Next, we took an unbiased approach to the discovery of potential resistance mechanisms. Specifically, we obtained expression profiles of Ptch+/−p53−/− tumors using Affymetrix murine gene expression arrays and queried the data in a hypothesis-directed mode for signatures corresponding to a pattern of expression that was down-regulated upon short-term treatment with NVP-LDE225 but reexpressed in resistant tumors (Fig. 2A). Genes ordered by Spearman rank correlation with this pattern are shown in Fig. 2, B and C. Gli1 emerged as the top-ranking gene, closely followed by CyclinD1, Ptch1, and Hhip, three bona fide Hh pathway target genes (2). Using the Fisher’s exact test to probe gene sets extracted from the GeneGo Metacore database (11), we showed that the top-ranked genes were enriched for the transcriptional targets of Gli2 [P = 0.001, false discovery rate (FDR) = 0.04] and Gli1 (P = 0.003, FDR = 0.08). Sensitive and resistant tumors from the Ptch+/−Hic1+/− allograft model were subjected to the same analysis and also showed a significant regulation of Gli2 (P = 0.006) and Gli1 (P = 0.04) target genes. In aggregate, these data confirm and expand on our initial observation that Hh signaling is reactivated in resistant tumors.

Fig. 2

Smo-resistant Ptch+/−p53−/− tumors acquire Gli2 amplifications and are sensitive to Gli2 inhibition. RNA from sensitive tumors treated with either vehicle or NVP-LDE225 (20 mg/kg per day) for 4, 16, and 48 hours and from resistant tumors treated with 20 or 160 mg/kg per day (mpk) for 26 days (26 d) was profiled on Affymetrix mouse gene expression arrays. (A) Pattern of gene expression initially inhibited by NVP-LDE225 but reemerging in resistant tumors. Numbers express relative rank in expression. (B) Top-ranking genes by Spearman correlation matching the pattern in (A). (C) Heat map of the top-ranked genes associated with the pattern in (A). Each gene’s expression values are z-transformed for comparability, with red indicating relatively high expression and green indicating relatively low expression. (D) aCGH analysis with the Agilent Mouse Genome CGH Microarray Kit 244A of three resistant (LDE 1, 2, 3) and three sensitive (Veh 1, 2, 3) tumors identified a focal amplification in the region containing Gli2 on chromosome 1 in two of three resistant tumors. Copy number changes are expressed as log2. (E) Additional DNA from normal liver (NL), vehicle (control), and resistant tumors was analyzed by quantitative PCR for the Gli2 locus. (F) Correlation between levels of Gli2 mRNA expression and Gli2 copy number is shown for vehicle-treated control tumors (open square) and resistant tumors that emerged after treatment with NVP-LDE225 at 10 mg/kg per day bid (green square), 20 mg/kg per day qd (red diamond), 40 mg/kg per day bid (brown triangle), 80 mg/kg per day bid (blue circle), and 160 mg/kg per day bid (black inverse triangle). y axis in log10 scale. (G) Inhibition of Gli2 mRNA levels by siRNA knockdown of Gli2 was associated with decreased proliferation and Gli1 mRNA expression in a resistant Gli2-amplified (copy number: 20) and Gli2-overexpressing (17-fold) medulloblastoma tumor. Two independent Gli2 siRNAs (Gli2-1 and Gli2-1) were used.

Smo mutations in resistant tumors

First, we confirmed that Smo was still expressed in resistant tumors (fig. S6A) to exclude that the lack of response to NVP-LDE225 was caused by loss of its target Smo.

Resistance to inhibitors of BCR-ABL, c-KIT, and EGFR1 kinases is most often ascribed to the development of mutations in the direct drug target (4). In addition, a mutation in Smo was described as a mechanism of resistance to the Smo inhibitor GDC0449 (12). To determine whether point mutations in Smo might account for resistance to NVP-LDE225 and Gli reactivation in both medulloblastoma models, we subjected genomic DNA isolated from resistant tumors to polymerase chain reaction (PCR)–based amplification and sequencing of all coding Smo exons. Missense point mutations in Smo were detected in only 7 of 135 resistant tumors, resulting in changes of leucine-225 to arginine (L225R), asparagine-223 to aspartic acid (N223D), serine-391 to asparagine (S391N), aspartic acid–388 to asparagine (D388N), and glycine-475 to serine (G457S) (Table 1 and fig. S6, B and C). All five mutations differ from the previously described aspartic acid–477 to glycine (D477G) mutation (12) but similarly abrogate or decrease Smo inhibition by NVP-LDE225 (Table 1 and fig. S7). These data suggest that missense mutations in Smo are not a dominant driver of resistance to NVP-LDE225.

Table 1

Mutations rendering Smo resistant to inhibition by NVP-LDE225.

View this table:

Gli2 amplifications in resistant tumors

To determine whether other genetic abnormalities, including chromosomal alterations, might account for resistance to Smo inhibition, we subjected genomic DNA isolated from three sensitive and three resistant Ptch+/−p53−/− tumors to genome-wide array-based comparative genomic hybridization (aCGH) analysis. Two of three resistant tumors showed a focal amplification of a region on chromosome 1 (1qE2-4) containing Gli2 (Fig. 2D). Next, copy number variations in Gli1, Gli2, and Gli3 were determined by quantitative PCR in a larger set of resistant tumor samples. This analysis revealed Gli2 amplification in 50% of Ptch+/−p53−/− (Fig. 2E) and in 20% of resistant Ptch+/− tumors (fig. S8A), but not in sensitive tumors (Fig. 2E) or in any of the resistant Ptch+/−Hic+/− tumors. No copy number changes for Gli1 and Gli3 were detected in any of the models (fig. S8B). Gli2 amplifications appeared to be less frequent in tumors that had been treated with higher doses of the drug, but larger sample numbers will be required to draw a firm conclusion. In keeping with the notion that amplification would result in up-regulation of Gli2 mRNA levels, we found a correlation between expression and amplification: Gli2 mRNA expression was increased 2 to 20 times more in Gli2-amplified resistant tumors than in drug-sensitive tumors (Fig. 2F). A small number of resistant tumors showed increased Gli2 mRNA expression in the absence of clear amplification, suggesting that alternative mechanisms may also lead to Gli2 mRNA up-regulation. In the Ptch+/−Hic+/− allograft model, Gli2 expression was not increased compared to vehicle-treated sensitive tumors (fig. S5B).

The functional significance of Gli2 amplification was investigated in freshly isolated cells from a Gli2-amplified and Gli2-overexpressing, NVP-LDE225–resistant tumor transfected with Gli2 small interfering RNA (siRNA). As shown in Fig. 2G, treatment with Gli2 siRNAs resulted in a 50 to 70% knockdown of Gli2 mRNA. This was correlated with inhibition of proliferation and also led to the suppression of Gli1 mRNA, a well-defined transcriptional target of Gli2 (13). Moreover, preliminary data indicated that knockdown of Gli2 resulted in the partial reconstitution of sensitivity to NVP-LDE225. The IC50 for growth inhibition for NVP-LDE225 shifted from >20 to 0.1 μM when Gli2 was knocked down in the resistant tumor (table S4). These data show that Gli2 is a critical effector of tumor cell growth downstream of mutations in the Ptch receptor and can act as a mediator of resistance to Smo inhibitors.

Up-regulation of IGF-1R–PI3K signaling in resistant tumors

Gli2 amplification was frequent in resistant tumors; however, it was not uniform. Furthermore, Gli2 amplifications were not detected in resistant Ptch+/−Hic1+/− tumors, suggesting that tumors may escape Smo inhibition through alternative routes. To search for such a mechanism, we probed the Ptch+/−p53−/− medulloblastoma expression data set with an expression vector to look for the emergence of new or up-regulated pathways not regulated by short-term treatment with NVP-LDE225 (Fig. 3A). We created a rank-ordered list of genes differentially expressed (by t test) between resistant tumors and all other tumors (control and treated sensitive) and reapplied the previously described gene set analysis to detect signaling pathways preferentially enriched during the emergence of resistance (Fig. 3, B and C, and table S5).

Fig. 3

The PI3K-mTOR pathway is up-regulated in NVP-LDE225–resistant Ptch+/−p53−/− tumors, and emergence of resistance is delayed by combination treatment with the Smo and PI3K inhibitors NVP-LDE225 and NVP-BKM120. (A) Affymetrix gene expression data were mined for genes not affected by short-term NVP-LDE225 treatment, but up-regulated in resistant tumors. (B) GeneGo pathway categories up-regulated in resistant tumors ranked by FDR scores. (C) Heat map of expression values of up-regulated genes in Akt, PIP3, and IGF-1R pathway category. Data normalized as in Fig. 2C. (D and E) Nude mice subcutaneously implanted with Ptch+/−p53−/− tumors were treated with vehicle (control), NVP-LDE225 (80 mg/kg per day qd), NVP-BKM120 (30 mg/kg per day qd), or the combination at the same doses and schedules starting on day 9 after implantation. (D) Tumor volume (mean ± SEM) (n = 8). At day 41 of treatment, the two groups are statistically different (P < 0.01). (E) Time to endpoint (tumor volume reaching 700 mm3) (n = 8). (F) Total protein isolated from tumors at the end of the study was evaluated for phospho-S6 (pS6) (S235/236), phospho-4EBP1 (p4EBP1) (T37/46), and total S6 and 4EBP1.

In this analysis, three of the most highly ranked pathways [Akt, PIP3 (phosphatidyl inositol 3,4,5-trisphosphate), and IGF-1R (insulin-like growth factor 1 receptor)] were directly related to IGF-1R–PI3K (phosphatidylinositol 3-kinase) signaling (Fig. 3B), strongly suggesting that a compensatory up-regulation of this pathway might contribute to the development of resistance. This mechanism of resistance has been observed previously with epidermal growth factor receptor (EGFR) inhibitors (4).

The 29-gene PI3K gene set in Fig. 3C derived from the Akt, PIP3, and IGF-1R pathway category was surveyed across an additional 3 vehicle (sensitive) and 16 resistant Ptch+/−p53−/− tumors (fig. S9). The “PI3K signature score” of each tumor, defined as the average z score of all genes in the 29-gene set with respect to the sensitive samples in the original Ptch+/−p53−/− experiment, was up-regulated in 11 of 16 resistant tumors (P < 0.01) but not in the 3 sensitive tumors. Gli2 amplification and Smo mutation were detected in 6 of 16 and 1 of 16 resistant tumors, respectively (table S6). Up-regulation of the PI3K signature was detected in tumors with and without Gli2 amplification.

To address the functional relevance of the PI3K up-regulation, we asked whether a combination of NVP-LDE225 with the PI3K class I inhibitor NVP-BKM120 (14) could block the development of resistance. After continuous treatment with NVP-LDE225, tumors derived from the Ptch+/−p53−/− allograft model regressed but then started to regrow, as seen previously (Fig. 3, D and E). However, the combination of NVP-LDE225 and NVP-BKM120 administered from the time of initial treatment delayed tumor regrowth. NVP-BKM120 as single agent, on the other hand, had no effect on tumor growth. Moreover, whereas the upfront concurrent administration of NVP-BKM120 and NVP-LDE225 was efficacious in delaying tumor regrowth, the treatment of established NVP-LDE225 resistant tumors with NVP-BKM120 did not result in statistically significant tumor growth inhibition (fig. S10). Western blot analysis of tumors from the different treatment groups demonstrated increased PI3K-mTOR (mammalian target of rapamycin) pathway activation in resistant tumors, as measured by phosphorylation of S6 and 4EBP1 (4E-binding protein 1), and inhibition of this pathway in tumors treated with NVP-BKM120 or the combination (Fig. 3F).

We expanded our studies to the Ptch+/−Hic+/− model that lacked Gli2 amplifications but, as for the Ptch+/−p53−/− allograft model, demonstrated up-regulation of the PI3K-mTOR pathway in resistant tumors (table S7). The combination of NVP-LDE225 and the dual PI3K-mTOR inhibitor NVP-BEZ235 (15) administered from the time of initial treatment resulted in a marked delay of tumor regrowth compared to treatment with single-agent NVP-LDE225 (Fig. 4, A and B). Moreover, whereas only one of eight tumors showed complete regression after 61 days of treatment in the group treated with NVP-LDE225 alone, five of eight tumors showed complete regression in the group treated with the combination of drugs (table S8). Similar results were obtained after treatment of NVP-LDE225 in combination with the mTOR inhibitor RAD001 (fig. S11, A and B). In keeping with these data, PI3K-mTOR pathway activation, as measured by S6 and 4EBP1 phosphorylation, was up-regulated in resistant Ptch+/−Hic+/− tumors and inhibited in tumors treated with NVP-BEZ235 (Fig. 4C) or RAD001 (fig. S11C).

Fig. 4

The emergence of resistance in Ptch+/−Hic+/− tumors is suppressed by combination treatment with the Smo and PI3K-mTOR inhibitors NVP-LDE225 and NVP-BEZ235. Nude mice subcutaneously implanted with Ptch+/−Hic+/− tumors were treated with vehicle (control), NVP-LDE225 (80 mg/kg per day qd), NVP-BEZ235 (40 mg/kg per day qd), or the combination at the same doses and schedules starting on day 8 after implantation. (A) Tumor volume (mean ± SEM) (n = 8). At day 49 of treatment, the two groups are statistically different (P < 0.02). (B) Time to endpoint (tumor volume reaching 700 mm3). (C) Total protein isolated from tumors at the end of the study was evaluated for phospho-S6 (S235/236), phospho-4EBP1 (T37/46), and total S6 and 4EBP1.

In summary, our data, in two different models of medulloblastoma and with three different inhibitors of the PI3K-mTOR pathway, provide a strong rationale for the use of a concurrent combination of Smo antagonists with PI3K-mTOR inhibitors during medulloblastoma treatment and suggest that this approach may delay or prevent the development of resistance to Smo inhibitors.

Discussion

Several Smo antagonists including NVP-LDE225 are currently being evaluated in clinical trials in patients with advanced solid tumors, including medulloblastoma (16). However, development of resistance by tumors has emerged as a challenge to targeted therapeutics and may limit their anticancer efficacy (4). Indeed, evidence of resistance to Smo inhibition has recently been reported in a medulloblastoma patient whose disease progressed during therapy with the Smo antagonist GDC0449 (17).

Here, we describe our efforts to identify mechanisms of resistance to Smo antagonists in Ptch+/− medulloblastoma models and potential ways to overcome the resistance. We observed that the Hh pathway was reactivated in all tumors that developed resistance to NVP-LDE225 despite initial complete pathway suppression, a phenomenon frequently seen in cases of resistance to targeted agents. We demonstrated that tumors use various mechanisms to evade Smo inhibition, such as amplification of Gli2, mutation of Smo, and up-regulation of PI3K signaling. Note that we currently cannot distinguish whether the resistance is due to the drug-mediated selection of preexisting resistant subpopulations or the consequence of a drug-induced change that renders cells resistant.

Gli2, a key mediator of Hh signaling downstream of Smo (13), was amplified in about 50% of resistant Ptch+/−p53−/− tumors and in 20% of resistant Ptch+/− tumors and was able to drive resistant tumor growth. It is possible that the genomic instability induced by p53 loss contributes to the increased frequency of Gli2 amplification in resistant Ptch+/−p53−/− tumors. Gli2 amplification has been observed in human medulloblastoma (18), albeit at low frequency, and it remains to be seen whether Gli2 amplification will be more frequently observed in medulloblastoma patients who develop resistance to Smo antagonists. Mutations in Smo resulting in loss of sensitivity to NVP-LDE225 constituted another mechanism of resistance and were detected in about 5% of resistant tumors in our study. Gli2 amplification and Smo mutation seemed largely mutually exclusive. Recently, a mutation in Smo (D473H) was identified in a medulloblastoma patient who developed resistance to the Smo antagonist GDC0449 (12, 17). The D473H mutation rendered Smo resistant to inhibition by GDC0449. A corresponding mutation in mouse Smo (D477G) was subsequently identified in a Ptch+/−p53−/− mouse tumor that became resistant to GDC0449 in a subcutaneous allograft model similar to the one used in this study (12). This example validates the use of the subcutaneous allograft model for the prediction of potential resistance mechanisms in the human setting. Resistance studies with spontaneously arising tumors in Ptch+/−p53−/− or Ptch+/−Hic+/− transgenic mice are difficult because of the limited amount of material that can be derived from these spontaneous mouse medulloblastomas. Mutations identified in our study differed from the D477G mutation, suggesting that various mutations can render Smo resistant to antagonists. Moreover, it is likely that the mutation spectrum and frequency will differ depending on the antagonist. In the future, the extent of cross-resistance will be important to understand and will help inform whether treatment failure on one Smo inhibitor can be rescued by a structurally distinct inhibitor.

Unexpectedly, we identified up-regulation of IGF-1R–PI3K signaling as another resistance mechanism by profiling of gene expression changes in resistant versus sensitive tumors. The importance of the compensatory up-regulation of this pathway was demonstrated by the ability to delay or prevent the emergence of resistance by combining the Smo antagonist NVP-LDE225 with PI3K-mTOR inhibitors. Although determination of the underlying mechanism of IGF-1R–PI3K pathway up-regulation in resistant tumors will require further investigation, examination of the aCGH data did not reveal overt genetic alterations such as deletion of Pten or amplification of Pi3k or Akt alleles. However, increased expression of IGF2 and its receptor was observed in most of the resistant tumors. IGF-1R and Hh signaling appear to synergize in promoting proliferation of cerebellar neuronal precursors and the formation of medulloblastoma tumors (1921), and IGF2 is required for the progression to advanced medulloblastoma in Ptch+/− mice (22). Moreover, IGF2, through PI3K signaling, potentiates Gli activation induced by low concentrations of Hh ligand (23). It is possible that under conditions of continuous Hh pathway inhibition, the IGF-1R–PI3K pathway compensates for the loss of Hh signaling and thus becomes a mediator of resistant tumor growth. How far this occurs in synergy with residual levels of Hh activity or promotes the expansion of clones that harbor Gli2 amplifications, Smo mutations, or other genetic or epigenetic changes needs to be further explored.

In summary, these data indicate that the concurrent combination of Smo antagonists with modulators of the PI3K-mTOR pathway is a potentially useful strategy to delay or prevent the development of resistance to Smo antagonists and may inform treatment strategies for medulloblastoma and other Smo-dependent human cancers.

Materials and Methods

Medulloblastoma allograft studies

Tumors derived from Ptch+/−p53−/− and Ptch+/−Hic+/− transgenic mice were serially passaged as fragments in nude mice. For efficacy studies, tumor fragments were dissociated into single cells, and 5 × 106 cells were allografted into nude mice and treated with small-molecule inhibitors as previously described (5, 24). Tumor volumes were measured three times a week and calculated with the following ellipsoid formula: (length × width2)/2. We note that tumor kinetics vary between studies, most likely a reflection of passage number or different batches of nude mice or reagents. NVP-LDE225 was formulated as diphosphate salt in 0.5% methylcellulose and 0.5% Tween 80 (Fisher), NVP-BKM120 in 0.5% methylcellulose, NVP-BEZ235 in one volume of NMP (1-methyl-2-pyrrolidone; Sigma-Aldrich) and nine volumes of PEG 300 (polyethylene glycol 300; Sigma-Aldrich), and RAD001 in water. Doses are expressed as free base equivalents. Compound formulations were dosed by oral gavage. Tumors were harvested for analysis 4 hours after the last dose unless stated otherwise in the legend. All animal studies were carried out according to the Novartis Guide for the Care and Use of Laboratory Animals. Statistical analysis for tumor regrowth was done by one-way analysis of variance (ANOVA) on ranks (Tukey test) on the day stated.

Ex vivo medulloblastoma assay

Tumors were minced and a single-cell suspension was prepared with the Papain Dissociation System (Worthington Biochemical Co.) as described (10). Cells were resuspended in serum-free neurobasal medium (with B27 supplement) (Invitrogen) and plated in 96-well plates at a density of 3 × 105 per well in 200 μl of medium. Serial dilutions of inhibitors were prepared in dimethyl sulfoxide (DMSO) and added at 1 μl per well. Drug was added once at the start of the experiment. Cells were incubated for 48 hours, and [3H]thymidine was added for the last 8 hours to assess cell proliferation. Incorporated radioactivity was quantified as previously described (10). siRNA transfections with scrambled siRNAs (ON-TARGETplus Non-targeting Pool, Dharmacon) and mGli2 siRNAs (Gli2 siGENOME, Dharmacon) were applied with the DharmaFECT1 transfection reagent according to the manufacturer’s instructions (Dharmacon).

Immunoblot analysis

Cell lysates were prepared and analyzed by immunoblot for phospho-S6 (S235/236), total S6, phospho-4EBP1 (T37/46), and total 4EBP1 (Cell Signaling Technology) as described (25).

Smo-binding and cell-based assays

Agonist displacement assays and TM3-Gli-luciferase assays were performed as previously described (24). HEPM cells [American Type Culture Collection (ATCC) CRL-1486] were cultured in minimum essential medium (Gibco) supplemented with 10% fetal calf serum. Cells were plated at 5 × 104 per well in 96-well plates and stimulated with recombinant SHH (R&D Systems) for 48 hours in the presence of serial dilutions of NVP-LDE225. Gli1 mRNA levels were determined at the end of the assay as described below. Smo point mutations were introduced into pcDNA3.1 containing hemagglutinin-tagged Smo with the QuikChange Lightning Site-Directed Mutagenesis kit (Stratagene). Wild-type and mutant Smo constructs were transiently expressed in C3H10T1/2 (ATCC CCL-226) with a Gli-luciferase reporter and pRL-TK expressing Renilla luciferase with GeneJuice transfection reagent as described (12). Serial dilutions of NVP-LDE225 (0.001 to 10 μM final concentration in assay) were added 24 hours after transfection. Firefly and Renilla luciferase activity was detected after an additional 24 hours with the Dual-Luciferase Reporter Assay System (Promega). Percent inhibition was calculated relative to DMSO control.

Gene expression analysis

RNA isolation from tumors, complementary DNA (cDNA) synthesis, and real-time quantitative PCR were performed as described (24). PCR probes used are as follows: mGli1, Mm494646m1; mGli2, Mm01293117m1; mPtch1, Mm00436026m1; mPtch2, Mm00436047m1; mCyclinD1, Mm00432359m1; hGli1, Hs0017190 (Applied Biosystems).

Generation of labeled cDNA and hybridization to 430_2 murine arrays (Affymetrix) were performed as described (26). Expression values were normalized with the Affymetrix MAS5.0 algorithm. Probe sets with MAS5.0 expression below 100 in 90% of samples were excluded from analysis. The remaining probe sets were compared with the pattern in Fig. 2A using the Spearman rank correlation, and tested for differential expression as in Fig. 3A using a homoscedastic t test. Using the gene selection methods above, we assessed probe sets with nominal P values of <0.01 for membership in gene sets (transcription factor sets and canonical pathways) extracted from the GeneGo Metacore database (11). Significance values were calculated with the Fisher’s exact test and Benjamini-Hochberg FDR correction (27). Genes with multiple probe sets were considered for set membership if any constituent probe sets met the selection criteria. Mouse genes were converted to human homologs with the National Center for Biotechnology Information HomoloGene database, August 2009 build.

DNA copy number and sequence analysis

Genomic DNA was extracted from tumors with the DNeasy Blood and Tissue kit (Qiagen) and subjected to copy number analysis with the Agilent Mouse CGH 244K array containing 244,000 features with a median probe spacing of 7.8 kb per the manufacturer’s instructions. The data were analyzed with the Agilent G4175AA CGH Analytics 3.4 software for copy number alterations. Genomic copy number for Gli1, Gli2, or Gli3 was determined with custom-designed quantitative PCR reagents synthesized by Applied Biosystems (Gli1: forward primer, CATTGCCTTTTCTCCTTGTCATCTG; reverse primer, GGCGGTCCAGGGAGACT; probe, CACCTGTGTCTCGCCGTC; Gli2: forward primer, CCCGTGGGTCTTCTCTCTGA; reverse primer, GACAGGGCTGCCACTTAGG; probe, CCTCCACAGGCCTCC; Gli3: forward primer, CTCATCTTTTCCCTGCCTTCCA; reverse primer, ACATGTAATGGAGGAATAGGAGATGGA; probe, CCTCATGATGTCTGGCATC). Real-time PCR was carried out in a 384-well plate and run with the 7900HT Fast Real-Time PCR System (Applied Biosystems) with the default cycling method (50°C for 2 min, 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min). The reaction volume was 12 μl, and the mixture included 900 nM of each primer, 250 nM of probe, 1× TaqMan universal master mix (containing PCR buffer, nucleotides, and Taq DNA polymerase), and 10 ng of genomic DNA template. Copy numbers were calculated with six replicate reactions for each DNA sample with a standard curve constructed with four replicates of fourfold serial dilution of normal genomic DNA template, ranging from 40 to 0.04 ng. Copy number was calculated as 2(TDNA/CDNA), where TDNA and CDNA are the calculated amounts of test gene DNA at the recorded Ct for tumor and calibrator, respectively. Copy number data for Gli2 were normalized to Gli3 with the formula 2(Tdna/LdnaT)/(Cdna/LdnaC), where Tdna and Cdna represent the amounts of Gli2-calculated DNA in the tumor and calibrator, respectively, and LdnaT and LdnaC are the corresponding amounts of their Gli3 DNA at the recorded Ct values. Mutation analysis was performed by sequencing of PCR-amplified exon sequences of Smo (Agencourt Bioscience).

Supplementary Material

www.sciencetranslationalmedicine.org/cgi/content/full/2/51/51ra70/DC1

Fig. S1. Chemical structure of NVP-LDE225.

Fig. S2. H&E staining of sensitive and resistant Ptch+/−p53−/− tumors.

Fig. S3. NVP-LDE225 initially induces Hh pathway inhibition in Ptch+/−p53−/− model, followed by development of resistance associated with reactivation of the pathway.

Fig. S4. NVP-LDE225 initially induces Hh pathway inhibition and tumor regression in Ptch+/−Hic+/− model, followed by development of resistance.

Fig. S5. NVP-LDE225 initially induces Hh pathway inhibition in Ptch+/−Hic+/− model, followed by development of resistance associated with reactivation of the pathway.

Fig. S6. Characterization of Smo in resistant Ptch+/−p53−/− and Ptch+/−Hic+/− tumors.

Fig. S7. Smo mutants retain signaling activity but are resistant to inhibition by NVP-LDE225.

Fig. S8. Gli2 amplifications in resistant Ptch+/− and Ptch+/−p53−/− tumors.

Fig. S9. PI3K pathway up-regulation in resistant Ptch+/−p53−/− tumors.

Fig. S10. Treatment with NVP-BKM120 does not result in statistically significant tumor growth inhibition of resistant Ptch+/−p53−/−medulloblastoma.

Fig. S11. Emergence of resistance is suppressed by combined treatment with Smo and mTOR inhibitors NVP-LDE225 and RAD001.

Table S1. IC50 values for NVP-LDE225 in Smo-binding and Hedgehog pathway inhibition assays.

Table S2. Number of complete tumor regressions in Ptch+/−Hic+/− allograft model at different time points upon treatment with NVP-LDE225.

Table S3. IC50 values in ex vivo proliferation assay of Ptch+/−p53−/− medulloblastoma cells.

Table S4. IC50 values in ex vivo proliferation assay of resistant Ptch+/−p53−/− Gli2-amplified medulloblastoma cells.

Table S5. Pathway categories for Ptch+/−p53−/− study matching pattern depicted in Fig. 3A.

Table S6. Relative frequency of mechanism of resistance in the Ptch+/−p53−/− allograft model.

Table S7. PI3K pathway categories for Ptch+/−Hic+/− study matching pattern depicted in Fig. 3A.

Table S8. Number of complete tumor regressions in Ptch+/−Hic+/− allograft model treated with NVP-LDE225 or NVP-BEZ235 alone or in combination at different time points.

Footnotes

  • * These authors contributed equally to this work.

  • Present address: Cancer Research Technology, Gower Street, London WC1E 6BT, UK.

  • Present address: Sanofi-Aventis, 13 Quai Jules Guesde, 94403 Vitry-sur-Seine, France.

  • § Present address: Sanofi-Aventis, Cambridge, MA 02139, USA.

  • Citation: S. Buonamici, J. Williams, M. Morrissey, A. Wang, R. Guo, A. Vattay, K. Hsiao, J. Yuan, J. Green, B. Ospina, Q. Yu, L. Ostrom, P. Fordjour, D. L. Anderson, J. E. Monahan, J. F. Kelleher, S. Peukert, S. Pan, X. Wu, S.-M. Maira, C. García-Echeverría, K. J. Briggs, D. N. Watkins, Y.-m. Yao, C. Lengauer, M. Warmuth, W. R. Sellers, M. Dorsch, Interfering with resistance to smoothened antagonists by inhibition of the PI3K pathway in medulloblastoma. Sci. Transl. Med. 2, 51ra70 (2010).

References and Notes

  1. Acknowledgments: We thank N. Hartmann and F. Staedtler in the Genomics and Genetics Applications core group in Novartis Institutes for Biomedical Research for performing the expression profiling; E. Lobenhofer and A. Field at Cogenics Inc. for the aCGH profiling. We thank R. Segal for providing Ptch+/−p53−/− tumors and R. Mosher for histopathology support. Funding: D.N.W. was supported by NIH/National Institute of Neurological Disorders and Stroke grant R01 NS054085-01A1. Author contributions: M.D. conceived and directed the project. S.B., J.W., Y.Y., R.G., J.Y., B.O., Q.Y., and J.G. designed, executed, and analyzed pharmacology studies. M.D., J.F.K., X.W., A.W., A.V., and K.H. designed and carried out cellular and biomarker studies. Genomic profiling studies were designed and analyzed by M.M., J.E.M., P.F., D.L.A., and L.O. S. Pa and S. Pe directed the Smo antagonist chemistry. S.-M.M. and C.G.-E. provided NVP-BEZ235 and input to study design. K.J.B. and D.N.W. provided the Ptch+/−Hic+/− model. C.L., M.W., and W.R.S. provided input into experimental designs. M.D., S.B., and W.R.S. wrote the manuscript. Competing interests: Most of the authors are employees of Novartis Pharmaceuticals. Accession numbers: Accession numbers for array data in Gene Expression Omnibus are as follows: GSE19657, GSE22005, and GSE22006.
View Abstract

Navigate This Article