Erratum

Erratum for the Research Article: “Circulating tumor DNA methylation profiles enable early diagnosis, prognosis prediction, and screening for colorectal cancer” by H. Luo, Q. Zhao, W. Wei, L. Zheng, S. Yi, G. Li, W. Wang, H. Sheng, H. Pu, H. Mo, Z. Zuo, Z. Liu, C. Li, C. Xie, Z. Zeng, W. Li, X. Hao, Y. Liu, S. Cao, W. Liu, S. Gibson, K. Zhang, G. Xu, R.-h. Xu

See allHide authors and affiliations

Science Translational Medicine  22 Apr 2020:
Vol. 12, Issue 540, eabc1078
DOI: 10.1126/scitranslmed.abc1078

In the Research Article “Circulating tumor DNA methylation profiles enable early diagnosis, prognosis prediction, and screening for colorectal cancer,” the procedure for performing droplet digital PCR was incorrect in the Supplementary Materials and Methods. The original text stated that “an aliquot of each sample was pre-amplified, diluted 1: 3000, and then PCR-amplified using fluorescent, dual-labeled primer-probe sets specific for cg10673833 from Behavioral Diagnostics (available for sale via IBI Scientific, www.ibisci.com) and Universal Digital PCR reagents and protocols from Bio-Rad.” The authors have corrected this text to indicate that “the PCR primers and dual labeled fluorescent probes in the ddPCR assay were as following: forward primer, 5'- GTTTTATAAGGAGGTTGTGTT; reverse primer, 5'-AACIAAAAACCCTCCAAA; probe for methylated allele detection, 5'- FAM/GAGGGGTCGGATGTTGG/BHQ1-3'; and probe for unmethylated allele detection, 5'-HEX/GAGGGGTTGGATGTTGGG/BHQ1-3'. The following cycling conditions were used: 98°C for 10 min, followed by 40 cycles at 98°C for 30 s and 53°C for 60 s, and finally 98°C for 10 min. The primers and probes were custom designed and synthesized by Thermo Fisher Scientific (www.thermofisher.com/cn/en/home/life-science/oligonucleotides-primers-probes-genes/applied-biosystems-custom-primers-probes.html). The ddPCR Supermix for Probes (Cat.18630125) and other universal Digital PCR reagents and protocols were purchased from Bio-Rad (www.bio-rad.com/en-cn/category/digital-pcr?ID=M9HE2R15).” The Supplementary Materials PDF has been corrected.

Stay Connected to Science Translational Medicine

Navigate This Article