Research ArticleHIV

Abundant HIV-infected cells in blood and tissues are rapidly cleared upon ART initiation during acute HIV infection

See allHide authors and affiliations

Science Translational Medicine  04 Mar 2020:
Vol. 12, Issue 533, eaav3491
DOI: 10.1126/scitranslmed.aav3491

Clearing a path for an HIV cure

Curing HIV is more feasible if we better understand the formation of the latent viral reservoir. Leyre et al. studied longitudinal blood and tissue samples during acute HIV infection. The large pool of infected cells present at early stages did not survive antiretroviral treatment. Infected cells at later stages were more prevalent in lymphoid tissues than in blood. These results show that most infected targets are cleared with early treatment, but HIV+ cells that remain after a certain stage are more likely to persist. These persistent cells are the ones that will need to be eradicated for a cure to be achieved.

Abstract

The timing and location of the establishment of the viral reservoir during acute HIV infection remain unclear. Using longitudinal blood and tissue samples obtained from HIV-infected individuals at the earliest stage of infection, we demonstrate that frequencies of infected cells reach maximal values in gut-associated lymphoid tissue and lymph nodes as early as Fiebig stage II, before seroconversion. Both tissues displayed higher frequencies of infected cells than blood until Fiebig stage III, after which infected cells were equally distributed in all compartments examined. Initiation of antiretroviral therapy (ART) at Fiebig stages I to III led to a profound decrease in the frequency of infected cells to nearly undetectable level in all compartments. The rare infected cells that persisted were preferentially found in the lymphoid tissues. Initiation of ART at later stages (Fiebig stages IV/V and chronic infection) induced only a modest reduction in the frequency of infected cells. Quantification of HIV DNA in memory CD4+ T cell subsets confirmed the unstable nature of most of the infected cells at Fiebig stages I to III and the emergence of persistently infected cells during the transition to Fiebig stage IV. Our results indicate that although a large pool of cells is infected during acute HIV infection, most of these early targets are rapidly cleared upon ART initiation. Therefore, infected cells present after peak viremia have a greater ability to persist.

INTRODUCTION

Although lifelong suppression of HIV replication with antiretroviral therapy (ART) now seems possible, medication side effects, the risk for drug resistance, stigma, and substantial costs all contribute to the necessity of finding a cure (1, 2). ART alone does not eradicate HIV: even after more than 15 years of intensive and continuous therapy, viral rebound occurs within a few weeks upon cessation of ART in all but exceptional cases (3, 4).

HIV persists in a latent form in a small pool of long-lived memory CD4+ T cells (57), which is considered the major obstacle to eradication (8). HIV latency may be directly established in resting CD4+ T cells (9) or during the contraction phase of the immune response when the antigen load decreases and activated cells transition from an effector to a memory phenotype (10). Although the first model implies that latently infected cells are generated during the first hours after viral dissemination, the temporal constraints of memory T cell generation involved in the second model suggest that latently infected cells may not be established during the first days of infection. Regardless of the mechanism by which latently infected cells are generated, a persistent viral reservoir is unavoidably established rapidly both in HIV-infected humans and in simian immunodeficiency virus (SIV)–infected nonhuman primates (NHPs) and is the source of viral rebound upon ART cessation, even when suppressive therapy is initiated at the earliest sign of infection (11, 12). This pool of infected cells harboring replication competent HIV is maintained by survival and homeostatic- and antigen-induced proliferation (1319).

During the past decade, considerable efforts have been made to reduce the size of this persistent reservoir and to facilitate its immune control, with the objective of developing a functional cure for HIV infection. Unfortunately, most of these approaches have had minimal impact on the size of the reservoir (2023) and did not result in a substantial delay to viral rebound or in a lower viral set point upon ART cessation (24, 25). To date, early initiation of ART is the only intervention that has a measurable and reproducible impact on the size of the HIV reservoir in humans.

During acute infection, plasma viral load increases rapidly and then falls to reach a viral set point (2629). ART initiation early in infection leads to a rapid decay in viremia and in the frequency of circulating infected cells at all stages (3033). However, the frequency of infected cells in blood and tissues from individuals at the earliest stages of HIV infection and how the size of this pool is affected by ART remain unclear. In the absence of ART, most infected cells contain labile forms of unintegrated viral DNA (34), which precedes integrated viral DNA and is followed by productive infection and, usually, rapid cell death (3537). Although most of the viral genomes are intact at the earliest phase of infection (38), defective proviruses rapidly accumulate (39).

Individuals who start ART early in infection display a smaller reservoir compared to those initiating ART at a later stage (32, 33, 4045). Although early ART markedly curbs the size of the persistent reservoir during therapy, most early-treated individuals experience rapid viral rebound after analytic treatment interruption (11, 43, 46). Studies in NHPs revealed that although early ART restricts the pool of SIV-infected cells (47), a long-lived reservoir harboring replication-competent SIV is already established 3 days after infection when plasma viremia is not yet detectable (12). In these models, lymphoid tissues appear to represent preferential reservoirs for persistent SIV during ART (48). However, because of the difficulty of accessing samples from individuals at the earliest stage of HIV infection, the tissues and cell subsets in which this reservoir is primarily established and maintained in humans remain largely unidentified. Because blood harbors relatively few T cells compared to lymphoid tissues, such as lymph nodes and gut-associated lymphoid tissue, which are known to be preferential sites for HIV persistence during ART (4952), analyzing blood and tissues collected from individuals at the earliest phase of HIV infection is crucial to identify the compartments in which the HIV reservoir is seeded and persists during ART.

In this study, we sought to identify the tissues and cell subsets in which HIV establishes and maintains its reservoir in a cohort of acutely infected individuals who initiated ART at the earliest stage of HIV infection. The RV254/SEARCH 010 cohort enrolls acutely infected individuals in Fiebig stages I to V who initiate ART within a median time of 2 days after diagnosis. In a subset of participants, lymph nodes and sigmoid colon tissues were obtained, and large numbers of peripheral blood mononuclear cells (PBMCs) were collected by leukapheresis, allowing us to study the establishment of cellular and tissue reservoirs during acute infection and their persistence during ART.

RESULTS

The frequency of HIV-infected cells in tissues rapidly increases throughout acute infection

Most participants were male (96%) with a median age of 27 years [interquartile range (IQR), 23 to 33], and most of them (69%) were infected with HIV-1 CRF01-AE (Table 1). As expected, HIV-1 plasma viral loads were relatively low in Fiebig I participants [4.1 log10 copies per ml (IQR, 3.6 to 4.7)] and peaked at the Fiebig stage III [6.4 log10 copies per ml (IQR, 5.77.0); fig. S1A]. The CD4/CD8 ratio gradually decreased after the Fiebig stage II (fig. S1B), reflecting the depletion of CD4+ T cells and concomitant proliferation of CD8+ T cells (fig. S1, C and D).

Table 1 Clinical data of the participants at baseline.

MSM, men who have sex with men; TDF, tenofovir disoproxil fumarate; FTC, emtricitabine; EFV, efavirenz; RAL, raltegravir; MVC, maraviroc.

View this table:

To determine the timing and location of the establishment of the pool of infected cells during the earliest phases of HIV infection, we measured the frequency of cells harboring integrated HIV DNA in blood and tissues (inguinal lymph nodes and sigmoid colon biopsies) in recently infected individuals enrolled at different stages of acute HIV infection (Fiebig stages I to V) and in chronically infected controls. In the peripheral blood, integrated HIV DNA values showed a continuous increase through all acute infection stages but remained lower than values in chronic infection even in Fiebig stages IV/V participants (all comparisons to chronic, P < 0.001; Fig. 1A). Measurements of integrated HIV DNA in lymph nodes and sigmoid colon biopsies from these participants revealed very different kinetics: Although infected cells were rarely detected in tissues from Fiebig I participants, maximal frequencies of lymph node and sigmoid colon cells harboring integrated HIV DNA were reached at the Fiebig stage II and remained stable through chronic infection (Fig. 1, B and C). This suggested that the bulk of infected cells is first established in tissues and that the virus subsequently disseminates in the blood, possibly through the recirculation of infected cells or because blood cells are infected at a later stage. Integrated HIV DNA was not detected in a substantial proportion of blood samples collected in recently infected participants (35%) but was often detected in matched lymph node or matched sigmoid colon from these individuals (79%, P = 0.04 and 76%, P = 0.08, respectively, compared to blood) (Fig. 1D), in sharp contrast with chronically infected controls who displayed detectable amounts of integrated viral genomes in all compartments. We frequently observed higher frequencies of cells harboring integrated HIV DNA in lymph node or sigmoid colon compared to peripheral blood in Fiebig stages I to III participants (Fiebig I: lymph node versus blood, P < 0.05; Fiebig stages II and III, sigmoid colon versus blood, P < 0.01 and P < 0.001, respectively; fig. S2, A to E). Most of these differences were still observed when only matched samples were included in the analysis (fig. S2, F and G). The contribution of tissue reservoirs to the initial levels of viral replication was further suggested by positive correlations between plasma HIV viral load and the frequencies of cells harboring integrated HIV DNA in lymph node and sigmoid colon [P < 0.0001 and correlation coefficient (r) = 0.68 and P = 0.002 and r = 0.40; Fig. 1, E and F, respectively]. To assess the relative ability of these compartments to support high levels of HIV replication, we measured the ratio of total and integrated HIV DNA among lymph nodes, sigmoid colon, and blood because this ratio is proposed to reflect active viral replication (53). Lymph node displayed a higher total/integrated HIV DNA ratio compared to sigmoid colon and blood (P < 0.01 for both comparisons; Fig. 1G), suggesting that the lymphoid tissue was a preferential site for HIV replication during acute infection. Collectively, these results indicate that the frequency of productively infected cells reached their maximal frequencies in tissues as early as Fiebig stage II and suggest that infected cells in lymph node likely contribute to the high levels of plasma viremia measured in acutely infected individuals.

Fig. 1 Rapid establishment of a large pool of infected cells in blood and tissues during acute HIV infection.

(A) Frequency of peripheral blood mononuclear cells (PBMCs) harboring integrated HIV DNA according to the Fiebig stage before antiretroviral therapy (ART) initiation (Fiebig I, n = 14; Fiebig II, n = 31; Fiebig III, n = 40; Fiebig IV/V, n = 12; and chronic, n = 37). (B) Frequency of lymph node mononuclear cells (LNMCs) harboring integrated HIV DNA according to the Fiebig stage before ART initiation (Fiebig I, n = 7; Fiebig II, n = 7; Fiebig III, n = 10; Fiebig IV/V, n = 6; and chronic, n = 3). (C) Frequency of colon cells harboring integrated HIV DNA according to the Fiebig stage before ART initiation (Fiebig I, n = 3; Fiebig II, n = 12; Fiebig III, n = 31; Fiebig IV/V, n = 10; and chronic, n = 7). In (A) to (C), each symbol represents an individual sample. Undetectable samples are plotted as “0” and are represented as open circles. Columns represent the median values with IQR. Values were transformed in log10([copies per 106 cells] + 1). Nonparametric Mann Whitney U tests were performed to compare Fiebig I to all other stages and chronic to all other stages: ns, P > 0.05; *P ≤ 0.05; **P ≤ 0.009; ***P ≤ 0.0009; and ****P ≤ 0.0001. (D) Percentages of lymph node, sigmoid colon biopsies, and blood matched samples with detectable and undetectable integrated HIV DNA in acutely infected individuals. Chi-square tests were performed to compare blood to colon, blood to lymph nodes, and colon to lymph nodes. (E and F) Correlations between plasma viremia and frequencies of cells harboring integrated HIV DNA in lymph nodes and sigmoid colon biopsies, respectively. Values were transformed in log10([copies per 106 cells] + 1), and the nonparametric Spearman’s tests were used to calculate P and r values. (G) Ratio between total and integrated HIV DNA values in lymph nodes, sigmoid colon biopsies, and blood during acute infection. The ratio between total HIV DNA and integrated HIV DNA was quantified in each sample and represented by individual symbols. Samples with undetectable integrated HIV DNA (denominator = 0) were excluded from the analysis. Columns represent the median values with IQR. A one-way ANOVA test was performed to compare the ratio between the three compartments: ns, P > 0.05; *P ≤ 0.05; **P ≤ 0.009; ***P ≤ 0.0009; and ****P ≤ 0.0001.

Initiation of ART in acute infection results in a rapid decay in the frequency of cells harboring integrated HIV DNA in blood and tissues

All participants started ART during acute infection and reached undetectable plasma viremia after a median time of 24 weeks (range, 2 to 36 weeks for minimal and maximal time), as described in a previous study (31). To determine whether the timing of ART initiation had an impact on the decay of HIV persistence markers, we measured total (which captures both integrated and unintegrated HIV genomes) and integrated HIV DNA and 2–long terminal repeat (LTR) circles, which represent dead-end products of failed infections, in longitudinal blood samples. Samples from individuals who started ART during chronic infection were compared to samples from 80 individuals who initiated ART at the earliest stages of HIV infection (including 11 Fiebig I participants). In individuals who started ART during the chronic infection, concomitant measures of integrated and total HIV DNA revealed that total HIV DNA measures paralleled integrated HIV DNA, whereas 2-LTR circles were detected at much lower levels relative to the other forms. The converse was observed in acutely treated individuals in whom total HIV DNA largely exceeded integrated HIV DNA and displayed similar kinetics to 2-LTR circles at baseline and up to 2 years of ART (Fig. 2A). This indicates that the total HIV DNA assay essentially captures unintegrated, likely irrelevant genomes in acutely infected individuals before and after ART initiation. Therefore, measures of integrated HIV DNA were used to longitudinally assess HIV persistence.

Fig. 2 ART initiation during acute infection leads to profound decreases in the frequency of infected cells in blood and tissues.

(A) Longitudinal measures of total, integrated HIV DNA, and 2-LTR circles in PBMCs from acutely infected participants (n = 81). Samples from chronically infected participants were used as controls (total, n = 16; integrated, n = 31; and 2-LTR, n = 13). Measurements were performed before treatment initiation and thereafter at 2, 12, 24, 36, 48, 72, and 96 weeks of ART for acutely treated participants and at weeks 0, 24, and 96 for chronically treated individuals. (B) Longitudinal quantifications of integrated HIV DNA in participants treated in acute versus chronic infection (Fiebig I, n = 11; Fiebig II, n = 27; Fiebig III, n = 34; Fiebig IV/V, n = 9; and chronic, n = 31). Nonparametric paired t tests were performed to compare baseline to 12 weeks measurements in acutely treated individuals and baseline to 48 and 96 weeks measurements in chronically treated participants. Quantifications were performed at the same time points as in (A). In (A) and (B), mean values and 95% confidence interval are represented. (C) Frequency of PBMCs harboring integrated HIV DNA after >24 weeks of ART (Fiebig I, n = 34; Fiebig II, n = 59; Fiebig III, n = 82; Fiebig IV/V, n = 30; and chronic, n = 41). (D) Frequency of LNMCs harboring integrated HIV DNA after >24 weeks of ART (Fiebig I, n = 6; Fiebig II n = 6; Fiebig III, n = 10; Fiebig IV/V, n = 7; and chronic, n = 5). (E), Frequency of sigmoid colon cells harboring integrated HIV DNA after >24 weeks of ART (Fiebig I, n = 7; Fiebig II, n = 11; Fiebig III, n = 22; Fiebig IV/V, n = 7; and chronic, n = 7). In (C) to (E), each symbol represents an individual sample. Open circles denote measurements below the limit of detection of the assay and are plotted as zero. Columns represent medians with IQRs. Values are transformed in log10([copies per 106 cells] + 1). Nonparametric Mann-Whitney t tests were performed to compare Fiebig I and chronic controls to all other stages: ns, P > 0.05; *P ≤ 0.05; **P ≤ 0.009; ***P ≤ 0.0009; and ****P ≤ 0.0001. (F) Quantity of integrated HIV DNA in acutely infected and treated individuals was compared to chronic controls (black bars). Columns represent median values. Nonparametric Mann Whitney t tests were performed to compare acutely infected participants from different Fiebig stages to chronic controls: ns, P > 0.05; *P ≤ 0.05; **P ≤ 0.009; ***P ≤ 0.0009; and ****P ≤ 0.0001. (G) Average fold decrease in the frequencies of cells harboring integrated HIV DNA in the blood, sigmoid colon biopsies, and lymph nodes according to the Fiebig stage after >24 weeks of ART. Columns represent mean values. (H) Average fold decrease in the frequency of circulating CD4+ T cells producing tat/rev RNA after PMA/ionomycin stimulation according to the stage of infection. Columns represent mean values. In (G) and (H), the limit of detection was used to calculate the ratio for undetectable samples.

Marked differences were observed in the dynamics of integrated HIV DNA among the different groups of individuals: Whereas the frequency of infected cells remained stable in participants who initiated ART during chronic infection, there was a sharp decay in the frequency of cells harboring integrated genomes in all acutely treated individuals during the first 12 weeks of therapy (Fig. 2B). Integrated HIV DNA remained undetectable at all time points in the vast majority of blood samples collected from individuals who initiated ART at the Fiebig stage I. Collectively, these observations indicate that compared to individuals starting treatment during chronic infection, participants who started ART during acute infection displayed lower frequencies of infected cells at baseline (Fig. 1A) and a faster decay upon ART initiation in the blood (Fig. 2B).

To determine whether HIV-infected cells predominantly persist in tissues from individuals who initiated ART early in infection, we compared the frequency of cells harboring integrated HIV DNA in blood, lymph node, and sigmoid colon biopsies after 24 to 96 weeks of therapy (Fig. 2, C to E). With the exception of an extremely low frequency of infected cells in PBMCs from one individual, ART initiation at the Fiebig stage I led to undetectable amounts of integrated HIV DNA in all blood and tissue samples available for analysis (fig. S3A). Early ART at any acute HIV infection stage was consistently associated with reduced frequencies of cells harboring integrated HIV DNA in blood, lymph node, and sigmoid colon when compared to individuals who initiated ART during chronic infection, with the exception of the Fiebig stages IV/V who displayed similar levels of integrated HIV DNA as chronic individuals in the sigmoid colon (Fig. 2, C to E). These lower frequencies of infected cells in tissues from acutely treated individuals were in sharp contrast with the measurements performed at baseline, in which Fiebig stages II to V were indistinguishable from chronically infected individuals (Fig. 2F). Overall, the average fold decreases in the frequency of infected cells were higher in acutely treated individuals than in participants treated in chronic infection (Fig. 2G). The rare proviruses that persisted after ART initiation during acute infection were more likely to be located in tissues (fig. S3, A to E). Similar observations were made when measuring the frequency of blood CD4+ T cells producing tat/rev transcripts using the Tat/Rev induced limiting dilution assay (TILDA) (Fig. 2H and fig. S3F), with more profound decreases in the frequency of infected cells when ART was initiated early, despite similar levels of infection measured at baseline.

Using the frequency of cells harboring integrated HIV DNA in blood, lymph nodes, and sigmoid colon and the proportion of CD4+ T cells in each compartment, we estimated the maximal and minimal absolute numbers of infected CD4+ T cells in the entire body of individuals at different stages of infection (fig. S3G). Before ART initiation, Fiebig I participants displayed the smallest absolute numbers of infected cells (range, 8 × 105 to 5 × 106 cells). The number of infected cells rapidly increased in Fiebig stages II and III (reaching up to 2 × 109 and 1 × 1010 cells, respectively) before decreasing in Fiebig stages IV/V and in chronically infected individuals (2 × 108 and 5 × 108 cells, respectively). ART initiation during chronic infection had a minimal impact on the total number of infected cells (range, 4 × 106 to 2 × 108), which was consistently higher than the total body reservoir size estimated in all acutely treated participants (ranges, 1 × 105 to 4 × 106, 5 × 105 to 6 × 106, 7 × 105 to 3 × 107, and 8 × 105 to 9 × 106 in Fiebig stages I, II, III, and IV/V, respectively). Together, these results indicate that although the frequencies of infected cells are elevated in tissues from acutely infected individuals, only a very small fraction of these cells will persist during ART, suggesting that the early pool of cells harboring integrated HIV DNA is short lived.

Infected memory CD4+ T cells are labile up to the Fiebig stage III

HIV primarily infects and persists in CD4+ T cells displaying a memory phenotype, with central (TCM), transitional (TTM), and effector memory (TEM) CD4+ T cells being the main contributors to the pool of infected cells during ART (5456), whereas naïve cells (TN) are rarely infected. To assess the effect of early ART initiation on the infection and persistence of infected memory cells, we sorted TN, TCM, TTM, and TEM cells from the blood of acutely infected participants before and after 24 to 96 weeks of ART.

At baseline, Fiebig I participants displayed low to undetectable amounts of integrated HIV DNA in all subsets (Fig. 3A). In contrast, infected TCM, TTM, and TEM cells were readily detected as early as the Fiebig stage II and throughout all infection stages (Fig. 3, B to E). Of note, there were no statistically significant differences in the infection frequencies of memory cells between Fiebig stages III, IV/V, and chronically infected individuals at baseline, indicating that the circulating pool of infected memory cells reaches its maximal size as early as the Fiebig stage III (fig. S4, A to D).

Fig. 3 HIV reservoir in CD4+ T cells subsets before and after ART initiation in acute infection.

(A to E) Frequency of sorted naïve, TCM, TTM, and TEM harboring integrated HIV DNA before and after >24 weeks of ART according to the Fiebig stage. (A) Fiebig I baseline, n = 7; ART, n = 6. (B) Fiebig II baseline, n = 8; ART, n = 6. (C) Fiebig III baseline, n = 8; ART, n = 16. (D) Fiebig IV/V baseline, n = 6; ART, n = 6. (E) Chronic baseline, n = 6; ART, n = 8. Nonparametric Mann Whitney t tests were performed to compare infection frequencies before and after ART in each CD4+ T cell subset according to the Fiebig stage: ns, P > 0.05; *P ≤ 0.05; **P ≤ 0.009; ***P ≤ 0.0009; and ****P ≤ 0.0001. Each point represents an individual sample. Open circles denote measurements below the limit of detection of the assay and are plotted as zero. Columns represent medians with IQR. Values were transformed in log10([copies per 106 cells] + 1). (F) Average fold decrease in the frequencies of cells harboring integrated HIV DNA in TCM, TTM, and TEM cells according to Fiebig stage. Columns represent mean values. Limits of detection were used for the undetectable samples. (G) Frequencies of naïve, TCM, TTM, and TEM cells harboring integrated HIV DNA after >24 weeks of ART in acutely treated individuals compared to chronically treated individuals. Columns represent median values. Open symbols denote measurements below the limit of detection of the assay and are plotted as zero. Values were transformed in log10([copies per 106 cells] + 1), and a one-way ANOVA was performed to compare the different CD4+ T cells subsets individuals treated in acute and chronic infection: ns, P > 0.05; *P ≤ 0.05; **P ≤ 0.009; ***P ≤ 0.0009; and ****P ≤ 0.0001.

Initiation of ART led to a marked decrease in the infection frequency of TCM, TTM, and TEM cells in Fiebig stages II and III participants (Fig. 3, B and C), whereas integrated HIV DNA levels were not affected in any of these subsets both in Fiebig stages IV/V and in chronically treated controls (Fig. 3, D and E). The average fold decrease of integrated HIV DNA levels in the three memory subsets was maximal in Fiebig III individuals and decreased in Fiebig stages IV/V participants and chronically infected controls in whom infection frequencies remained stable before and after ART (Fig. 3F). Even by assessing large numbers of memory cells obtained by flow cytometry cell sorting, we were unable to detect integrated genomes in TCM, TTM, and TEM from five of six participants who initiated ART at the Fiebig stage I (Fig. 3A). Whereas infection frequencies in TCM, TTM, and TEM cells were similar in individuals who initiated ART during chronic infection, the long-lived TCM cells displayed lower levels of integrated HIV DNA than TTM and TEM cells when ART was initiated in Fiebig stages I to V (Fig. 3G). Accordingly, the contribution of the TCM subset to the pool of infected cells was lower in suppressed individuals who initiated ART in acute infection compared to chronic controls (28 versus 44%, respectively; fig. S4, E to H). Together, these results indicated that most of the CD4+ T cells harboring integrated HIV DNA are cleared when ART is initiated during the Fiebig stages II and III of acute infection. In contrast, infected memory CD4+ T cells from Fiebig stages IV/V and chronically infected individuals had a greater ability to persist during ART and were more likely to display the phenotype of long-lived TCM cells.

DISCUSSION

Most of the studies that investigated the early events responsible for the establishment of a viral reservoir during the first few days/weeks of infection have been conducted in NHPs infected with SIV for logistical and technical reasons. The RV254/SEARCH 010 acute infection study provided a unique opportunity to identify the tissues and cell subsets that are targeted by HIV during the earliest stages of infection and to determine the impact of ART on these potential persistent reservoirs in humans. Consistent with the observations in macaques intrarectally infected with SIVMAC251 by Whitney et al. (12), we found that proviruses are more frequently detected in lymph nodes and sigmoid colon than in blood in recently infected individuals. The heightened total/integrated HIV DNA ratio we measured in lymph nodes suggests that viral replication may be prominent in this compartment, in line with previous studies indicating that the lymphoid tissues and particularly T follicular helper cells may be an important source of viremia during untreated HIV infection (51, 57, 58). This is supported by the strong correlation we observed between plasma viremia and the frequency of infected cells in this tissue. Of note, maximal infection frequencies in lymph nodes and sigmoid colon were already attained as early as Fiebig stage II, whereas the frequency of infected cells in blood gradually increased throughout all stages of acute HIV infection until the chronic phase, during which amounts of integrated DNA were comparable across the three compartments. These observations suggest that the lymphoid tissue may be a major source of HIV-infected cells at the earliest stage of infection before recirculation and accumulation in the blood.

In this study, we used integrated HIV DNA as a marker for HIV infection and persistence in blood and tissues. The concurrent measures of total and integrated HIV DNA and 2-LTR circles revealed important differences in the relative proportions of these molecular forms between acutely and chronically infected individuals. Chronically infected participants displayed low levels of 2-LTR circles and high amounts of total and integrated HIV DNA. Unexpectedly, 2-LTR circles were prominent in acute HIV infection and accounted for most of the HIV DNA molecules, whereas integrated genomes were rare, suggesting a possible defect in proviral integration at the earliest phase of HIV infection. Because 2-LTR circles are considered as dead-end forms for HIV replication (59), our results suggest that measuring total HIV DNA may considerably overestimate the pool of infected cells in acute infection. We acknowledge that all polymerase chain reaction (PCR)–based assays, including integrated HIV DNA, overestimates the frequency of cells carrying replication-competent virus (60) because a large fraction of viral genomes is defective (61). Although this difference may be less pronounced during the earliest stage of infection, it is still likely that our integrated assay captures many defective viral genomes. In an attempt to partially circumvent this problem, we used TILDA to measure the frequency of cells with inducible tat/rev RNA in a subset of the participants and observed that most of the samples obtained from people treated during Fiebig stages I to III were below the limit of detection of the assay. Therefore, we opted for the integrated DNA assay as a compromise to quantify HIV-infected cells because it is likely that any other assay would have resulted in negative results given the relatively limited amounts of cells available from blood and tissue samples from these acutely treated individuals.

Initiation of ART at the Fiebig stages I to III was associated with a profound decrease in the frequency of cells harboring integrated HIV DNA to nearly undetectable levels in all compartments. Initiation of ART during chronic infection led to only a modest decrease in the levels of integrated HIV DNA. The dynamic of integrated and nonintegrated viral genomes was elegantly studied by Koelsch et al. (62) who observed that ratios of the total HIV DNA levels to integrated HIV DNA levels were high before initiation of therapy but diminished during therapy. Similarly, we found that initiation of ART during chronic infection led to a rapid decay in total HIV DNA, whereas levels of integrated HIV DNA remained stable. In contrast, we observed that both forms decayed rapidly in acutely treated participants. This may be explained by the fact that most of the cells harboring integrated HIV DNA during acute infection are productively infected, whereas a large fraction of the integrated genomes from chronically infected participants are likely to be latent or defective (39) and therefore less prone to elimination. Previous studies have shown that productively HIV-infected cells are short lived (~2 days) (35, 36), whereas latently infected CD4+ T cells have a much longer half-life than productively infected cells (56, 63). These long-lived cells are likely to be generated at a constant but very low fraction of the total infection events at all stages of infection, and T cell proliferation may largely contribute to the expansion of the pool of latently infected cells during acute infection (19), as was previously demonstrated during ART (1316). In addition, although the relative contribution of viral cytotoxicity and cytotoxic T lymphocyte (CTL)–mediated killing to the elimination of these productively infected CD4+ T cells during acute infection remains unclear, it is possible that HIV-specific CD8+ T cells, which are still functional at this early stage, may also contribute to the observed rapid decay in the frequency of infected cells. In this same cohort of recently infected individuals, Takata et al. (64) reported that, during a very short window of time, potent HIV-specific CD8+ T cells are able to decrease the number of HIV-producing cells and also to decrease the seeding of the persistent viral reservoir after ART initiation. The emergence of CTL dysfunction may contribute to the stability of the pool of infected cells when ART is initiated during or after the Fiebig stage IV.

Our measures performed in PBMCs are in line with the study from Buzon et al. (33) who reported a faster decay of HIV DNA in the blood of individuals who started ART in early infection, leading to substantially lower frequencies of infected cells after long-term treatment. We observed that whereas integrated HIV DNA was rarely detected in the blood and sigmoid colon of participants who initiated ART during Fiebig stages II and III, persistently infected cells were readily detected in lymph nodes from these individuals (5 of 6 Fiebig II and 8 of 10 Fiebig III participants). This may be attributed to the low frequency of CD4+ T cells in the colon compared to lymph nodes (65), which would limit the efficient detection of HIV DNA in this preferential anatomical reservoir (66). It is also possible that the few proviruses that persist in early-treated individuals show greater stability in lymph nodes, which is consistent with the capacity of B cell follicles to serve as a sanctuary for HIV in the face of potent HIV-specific T cell responses (67).

Quantification of integrated HIV DNA in sorted memory CD4+ T cell subsets largely confirmed our observations in blood and tissues. ART had no measurable impact on the levels of integrated HIV DNA when therapy was initiated at the Fiebig stage IV or later. On the contrary, these frequencies were reduced by ART when therapy was initiated at an earlier stage, particularly before the Fiebig stage III, i.e., before the generation of HIV-specific antibodies. The distribution of integrated HIV DNA in CD4+ T cell subsets was also different between the acutely treated participants and the chronically treated controls, with a lower contribution of the long-lived TCM cells when ART was started early. This difference may reflect differential contributions of these subsets to the pool of infected cells before ART initiation. In addition, a prolonged contraction phase of the CD4+ T cell responses as a result of antigen clearance after ART initiation in chronic infection and/or increased levels of expression of exhaustion markers that facilitate latency establishment (68, 69) may also contribute to these differences.

Detection of integrated HIV DNA in blood and tissues from Fiebig I participants was extremely rare, both before and after ART. Because the numbers of cells collected by colon and lymph node biopsies were limited, one cannot exclude that these tissues contained low frequencies of infected that were not detected using our approach. Nonetheless, even by sorting memory CD4+ T cell subsets highly enriched in HIV DNA, we failed to detect infected cells in most of the Fiebig I participants in this study. Our measures performed in blood, sigmoid colon, and lymph nodes obtained from these rare individuals who initiated ART at the earliest stage of infection allowed us to estimate the total body reservoir between 0.2 × 106 and 4 × 106 cells, which is 30 to 600 times lower than our estimate in chronically treated individuals. Although our results indicate that initiation of ART at the earliest possible stage markedly restricts the pool of persistently infected cells, we recently reported rapid viral rebound in eight Fiebig I participants who interrupted therapy after a median of 2.8 years of viral suppression (11). Therefore, although early ART has a profound impact on the size of the viral reservoir, the clinical benefit of this intervention remains to be demonstrated. Estimates from Hill et al. (70) suggest that ∼2000-fold reductions in the frequency of infected cells would be required to permit most of the individuals to interrupt ART for 1 year without rebound. Together, our results and the recent report from Colby et al. (11) indicate that, although very early ART substantially limits the establishment of the reservoir, additional strategies are needed to further reduce its size to achieve viral control upon ART interruption, consistent with recent observations in the NHP model (71). Combining our estimates and Hill et al. (70), we predict that an additional three- to 60-fold reduction in the size of the reservoir may be necessary to observe transient control of viremia in Fiebig I participants after ART cessation in the absence of adjunctive therapy.

MATERIALS AND METHODS

Study design

The overall objective of this study was to measure the size of the pool of HIV-infected cells in blood and tissues during acute infection and to determine the impact of early ART initiation on these parameters. The RV254/SEARCH 010 cohort study (NCT00796146, clinicaltrials.gov) enrolls participants at the earliest stages of acute HIV infection at the Thai Red Cross AIDS Research Centre in Bangkok. High-risk volunteers are screened for acute HIV infection in real time with pooled nucleic acid testing and sequential immunoassay as previously described (44). Individuals with acute HIV infection were enrolled if they had a positive HIV RNA with or without a reactive immunoassay. ART was voluntary and offered to all participants and was initiated at a median (IQR) of 2 (0 to 5) days after enrollment (72) under a separate protocol (NCT00796263). Samples from chronically infected treatment naïve individuals from Bangkok were enrolled in the previously described SEARCH 011 (73) (NCT00782808), and RV304/SEARCH 013 (74) (NCT01397669) studies were also obtained. Several markers of HIV persistence including total and integrated HIV DNA and 2-LTR circles were measured in blood and tissues (lymph node and colon biopsies) collected at baseline and after viral suppression by ART. Primary data are reported in data file S1.

Ethics statement

All clinical studies were approved by the Institutional Review Boards of Chulalongkorn University in Thailand, Walter Reed Army Institute of Research, and University of California at San Francisco in the US, and the Centre Hospitalier de l’Université de Montréal in Canada. All participants gave written informed consent.

Fiebig staging

Participants were categorized as Fiebig stages I to V as follows: Fiebig I, positive HIV RNA, negative p24 antigen, and nonreactive third generation immunoassay; Fiebig II, positive HIV RNA, positive p24 antigen, and nonreactive third generation immunoassay; Fiebig III, positive HIV RNA, positive p24 antigen, reactive third generation immunoassay, and negative Western blot; Fiebig IV, positive HIV RNA, positive or negative p24 antigen, reactive third generation immunoassay, and indeterminate Western blot; and Fiebig V, positive HIV RNA, positive or negative p24 antigen, reactive third generation immunoassay, and positive Western blot except p31 (27).

Plasma viral load determination

HIV RNA in plasma was measured using the Roche Amplicor v1.5 UltraSensitive assay with a lower quantification limit of 50 copies per ml of plasma (Roche Diagnostics) or by the cobas TaqMan HIV-1 Test v2.0 (Roche Diagnostics) with a lower measurement limit of 20 copies/ml.

Quantification of total and integrated HIV DNA and 2-LTR circles

PBMCs were isolated from peripheral blood or leukapheresis by Lymphoprep density gradient centrifugation. Cryopreserved PBMCs were used to quantify the frequency of cells harboring HIV DNA (total, integrated, and 2-LTR circles) using previously described real-time PCR assays (75) with LTR-gag (for total), Alu-gag (for integrated), and 2-LTR junction (2-LTR) specific primers. Results were normalized to the number of copies of the CD3 gene (two copies per cell). To facilitate the comparisons between anatomic compartments, we assumed that each infected cell carries a single copy of HIV DNA, as previously described in circulating CD4+ T cells from both acutely and chronically untreated HIV-infected individuals (76). HIV DNA quantification was also performed in sigmoid colon biopsies stored in RNAlater and in lymph node mononuclear cells (LNMCs) isolated from inguinal lymph nodes, respectively. The sigmoid colon biopsies (n = 2 for each measure) were washed twice with PBS and resuspended in a fixed volume of 250 μl of proteinase K lysis buffer, as previously described (75). Lymph nodes were processed as follows: After removal of surrounding fat, the lymph nodes were minced and transferred through a 70-μm nylon cell strainer inserted into the top of 50-ml conical tube. Cells were washed, counted, and cryopreserved in fetal bovine serum/10% dimethyl sulfoxide. For DNA quantification, 1 × 106 LNMCs were transferred to a microtube, washed, and digested with proteinase K overnight. Only undetectable samples for which at least 100,000 cells in the blood and 65,000 cells in sigmoid/lymph node biopsies (as measured by CD3 copy numbers in the HIV DNA quantification assays) were included in the analysis (fig. S5). In all analyses, negative values were considered as “0,” except in the average fold decay calculations where limits of detection were taken into account.

The total number of infected cells in the entire body was calculated for each Fiebig stage by using the integrated HIV DNA values in each compartment and applying estimates from Ganusov et al. (77). We first calculated the infection frequencies of CD4+ T cells in each compartment by using the average percentage of CD4+ T cells (measured by flow cytometry) in each tissue and for each Fiebig stage and our integrated HIV DNA measures in each participant. Infection frequencies measured in lymph nodes were used to estimate the contribution of all secondary lymphoid organs. Infection frequencies measured in the sigmoid colon were used to estimate the contribution of mucosal tissues. Infection frequencies measured in the blood were used to estimate the contribution in the blood and spleen. We then calculated the average values for each Fiebig stage and for each compartment and added the absolute numbers of infected cells in the lymphoid tissues, mucosal tissues, and blood to obtain the total body reservoir.

TILDA

CD4+ T cells were isolated from cryopreserved PBMCs using magnetic depletion as per the manufacturer’s protocol (STEMCELL Technologies). The frequency of CD4+ T cells producing multiply spliced HIV RNA (tat/rev) after phorbol 12-myristate 13-acetate (PMA)/ionomycin stimulation for 12 hours was assessed using TILDA as previously described (78), with modified primers and probes for efficient amplification of HIV genomes of the A/E clade. The following primers were used for reverse transcription and preamplification: tat1.4AE (TGGCAGGAAGAAGCGGAAG) and revAE (TGTCTCTGYCTTGCTCKCCACC). For quantitative PCR, the following primers and probe were used: tat2AE (GCAGTAAGGATCATCAAAATCCTATACCAGAGCA), revAE, and probe MSHIVFAMzenAE (56-FAM/TTCYTTCGG/ZEN/GCCTGTCGGGTTCC/3IABkFQ).

Flow cytometry cell sorting

CD4+ T cell subsets were sorted on a BD FACSAria II cell sorter. The following antibodies were used: CD3–fluorescein isothiocyanate (clone HIT3a, BD no. 555339), CD4-allophycocyanin (APC) (clone SK3, BD no. 340443), CD45RA-APCH7 (clone HI100, BD no. 560674), CCR7-PE-Cy7 (clone 3D12, BD no. 557648), CD27–phycoerythrin (PE) (clone M-T271, BD no. 555441), and LIVE/DEAD Fixable Aqua (L34957, Invitrogen). Frequencies of memory CD4+ T cell subsets were determined as previously described after the exclusion of dead cells (LIVE/DEAD) (54). Four CD4+ T cell subsets were defined on the basis of the expression of CD45RA, CCR7, and CD27: TN (CD45RA+, CCR7+, and CD27+), TCM (CD45RA, CCR7+, and CD27+), TTM (CD45RA, CCR7, and CD27+), and TEM (CD45RA, CCR7, and CD27). Integrated HIV DNA was measured in the sorted populations. All subsets for which insufficient number of cells were analyzed (<40,000 sorted cells as measured in the PCR assay) were excluded from the analysis.

Statistical analysis

All data were analyzed using GraphPad Prism v6.0h. HIV DNA and TILDA values were transformed in log10([HIV copies per 106 cells] + 1). Undetectable values with a limit of detection equal or greater than 10 copies per 106 PBMCs, reflecting analysis of <105 cells, were excluded from the analysis. Undetectable tissue values with a limit of detection equal or greater than 15 copies per 106 cells were also excluded. Results were represented as median or mean values, with IQR or minimum and maximum values, as indicated in the figure legends. Mann-Whitney U test was used to compare participants between Fiebig stages. Correlations were determined using nonparametric Spearman’s test. One-way analysis of variance (ANOVA) was used to compare infection frequencies in different CD4+ T cell subsets and in different compartments. P values of ≤ 0.05 were considered statistically significant.

SUPPLEMENTARY MATERIALS

stm.sciencemag.org/cgi/content/full/12/533/eaav3491/DC1

Fig. S1. Viral load and T cell count at baseline in acutely infected participants.

Fig. S2. Frequencies of cells harboring integrated HIV DNA at baseline in the lymph node, colon, and blood.

Fig. S3. Frequencies of cells harboring integrated HIV DNA at >24 weeks of ART in the lymph node, sigmoid colon, and blood.

Fig. S4. Frequencies of memory CD4+ T cells harboring integrated HIV DNA at baseline.

Fig. S5. Number of cells sampled for integrated HIV measurements.

Data file S1. Primary data.

REFERENCES AND NOTES

Acknowledgments: We are grateful to the individuals who volunteered to participate in this study and the staff at the Thai Red Cross AIDS Research Centre and the Department of Retrovirology, U.S. Army Medical Component, Armed Forces Research Institute of Medical Sciences (AFRIMS). We thank the RV254/SEARCH 010, RV304/SEARCH 013, and SEARCH 011 protocols team members. We also thank the flow cores at VGTI Florida (Y. Shi and K. Kusser) and at the CRCHUM (D. Gauchat and A. Gosselin) for cell sorting, as well as the NC3 core at the CRCHUM (O. Debbeche). We thank R.-P. Sékaly and M. Massanella for advice and helpful discussions and A. Pagliuzza and E. Merlini for technical assistance. We also thank the RV254/SEARCH010, RV304/SEARCH013, and SEARCH011 study group members. Funding: The empirical component of this study was funded by the U.S. Military HIV Research Program, Walter Reed Army Institute of Research, Rockville, MD, USA, under a cooperative agreement (W81XWH-07-2-0067) with the Henry M. Jackson Foundation for the Advancement of Military Medicine Inc. at the U.S. Department of Defense and R01 NS061696 (V.G.V.). The scientific component of this study was supported by the Foundation for AIDS Research (108687-54-RGRL and 108928-56-RGRL, amfAR Research Consortium on HIV Eradication) and by the Canadian Institutes for Health Research (no. 364408). N. Chomont is supported by a Research Scholar Career Award of the Quebec Health Research Fund (253292; FRQ-S). Investigators were partially supported by R01AI125127 (T.W.S. and J.A.) and R01AI108433 (L.T. and J.A.). Author contributions: L.L. designed and performed the experiments, analyzed the data, and wrote the manuscript draft. E.K., C.S, D.J.C, N. Chomchey, and N.P. managed the participant recruitment, follow-up in the studies, and provided conceptual advice. C.V., W.B., and R.F. designed and performed part of the experiments. S.B. provided pellets of LNMCs and flow analyses on lymph nodes. A.S. provided flow analyses on gut biopsies. S.P. provided help in statistical analyses. M.d.S., S.A., R.T., and S.T. designed and managed the laboratory analyses for the clinical study. S.C., S.M., R.R., P.W., J.H.K., T.W.S., R.O., V.G.V., P.P., M.L.R., and N.M. provided support for the clinical studies. T.W.S. and L.T. provided conceptual advice. J.A. designed the clinical study, provided conceptual advice, and edited the manuscript. N. Chomont designed the experiments, analyzed the data, and wrote the manuscript draft. All authors read, edited, and approved the manuscript. Competing interests: J.A. has received honoraria from ViiV Healthcare, Merck, AbbVie, Gilead Sciences, and Roche Pharmaceuticals for her participation in advisory meetings. V.V. has consulted for Merck and ViiV Healthcare. N. Chomont is a board member of TheraVectys. All other authors declare that they have no competing interests. The views expressed are those of the authors. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, U.S. Army or Department of Defense, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government including the U.S. NIH. The investigators have adhered to the policies for protection of human subjects as prescribed in AR-70. Data and materials availability: All data associated with this study are present in the paper or the Supplementary Materials.

Stay Connected to Science Translational Medicine

Navigate This Article