Research ArticleSKIN

IFN-γ enhances cell-mediated cytotoxicity against keratinocytes via JAK2/STAT1 in lichen planus

See allHide authors and affiliations

Science Translational Medicine  25 Sep 2019:
Vol. 11, Issue 511, eaav7561
DOI: 10.1126/scitranslmed.aav7561

Identifying keratinocyte killers

Lichen planus is an inflammatory disease characterized by lesions on the skin or mouth. Although there are no approved treatments, T cell infiltration and keratinocyte death are thought to be involved. Shao et al. analyzed samples from patients and used an in vitro coculture system to identify immune pathways involved in this debilitating disease. They discovered that IFN-γ primed keratinocytes to become vulnerable to CD8+ cytotoxic T cells. As this axis depends on JAK/STAT signaling, JAK inhibitors already in the clinic for other indications could be used to prevent keratinocyte death, providing relief to patients with lichen planus.

Abstract

Lichen planus (LP) is a chronic debilitating inflammatory disease of unknown etiology affecting the skin, nails, and mucosa with no current FDA-approved treatments. It is histologically characterized by dense infiltration of T cells and epidermal keratinocyte apoptosis. Using global transcriptomic profiling of patient skin samples, we demonstrate that LP is characterized by a type II interferon (IFN) inflammatory response. The type II IFN, IFN-γ, is demonstrated to prime keratinocytes and increase their susceptibility to CD8+ T cell–mediated cytotoxic responses through MHC class I induction in a coculture model. We show that this process is dependent on Janus kinase 2 (JAK2) and signal transducer and activator of transcription 1 (STAT1), but not JAK1 or STAT2 signaling. Last, using drug prediction algorithms, we identify JAK inhibitors as promising therapeutic agents in LP and demonstrate that the JAK1/2 inhibitor baricitinib fully protects keratinocytes against cell-mediated cytotoxic responses in vitro. In summary, this work elucidates the role and mechanisms of IFN-γ in LP pathogenesis and provides evidence for the therapeutic use of JAK inhibitors to limit cell-mediated cytotoxicity in patients with LP.

INTRODUCTION

Lichen planus (LP) is a chronic inflammatory skin disease of unknown etiology characterized by often widespread pruritic skin lesions, and less commonly painful oral erosions, or nail involvement. Several subtypes have been described based on the morphology of the lesions and the site of involvement (1). Among them, hypertrophic LP (HLP) is characterized by pruritic hypertrophic or verrucous plaques typically on the lower limbs and tends to have a more chronic course (2). LP has a major impact on quality of life, particularly in those with oral LP (3). Histologically, LP is characterized by a dense band-like infiltration of lymphocytes in the upper dermis along the dermal-epidermal junction and keratinocyte apoptosis (4), an inflammatory pattern known as interface dermatitis. In addition, both oral and cutaneous LP have been reported to have the potential to transform to malignancy (5).

The immune mechanisms involved in LP pathogenesis have been shown to involve the activation of infiltrated T cells and the immune responses against keratinocytes. Patients with LP have increased numbers of CD8+ T cells in the skin and blood (6, 7), and in skin, CD8+ T cells are located in close proximity to dyskeratotic keratinocytes (8), consistent with cell-meditated cytotoxicity as a central mechanism in LP pathogenesis. CD4+ T cells, including T helper cell 1 (TH1), TH2, TH17, and T regulatory cells, have also been implicated as participants in LP (9), and epithelial-derived cytokines, chemokines, and costimulatory molecules may also play a crucial role, such as the TH1 chemokines chemokine (C-X-C motif) ligand (CXCL)9/10 (10). These data suggest that LP is a TH1-driven inflammatory phenotype with CD8+-mediated cytotoxicity.

Despite some recent progress, much is still unknown about the pathogenesis of LP, and there is urgent need for more effective treatments. Currently, there are no U.S. Food and Drug Administration (FDA)–approved treatments for LP. In this study, we aimed to illustrate the predominant cytokine via global gene expression in skin lesions and focused on the functions of interferon-γ (IFN-γ) and related potential targeted therapy for LP.

RESULTS

Transcriptomic profiling of LP lesions reflects an IFN-γ–dominant inflammation

To investigate the specific gene regulations in LP, microarray profiling was performed on RNA extracted from paraffin-embedded skin biopsy samples obtained from patients with LP (n = 20), HLP (n = 17), and healthy control samples from volunteers (n = 24). Principal components analysis demonstrated a complete separation between LP/HLP and healthy control samples, but a prominent overlap between LP and HLP (Fig. 1A). We identified 1447 and 1533 differentially expressed genes (DEGs) in skin lesions of LP and HLP compared with that in healthy control skin, respectively [false discovery rate (FDR), <0.1; fold change (FC), >1.5 or <−1.5; Fig. 1B and table S1]. Of these, 1104 genes, including 890 up-regulated genes and 214 down-regulated genes, were shared between LP and HLP (Fig. 1B). Gene Ontology pathways showed very similar enrichment for LP and HLP except that keratinization was more prominent in HLP, which is consistent with the clinical and histologic presentation of this disease (Fig. 1C). Further enrichment in LP and HLP DEGs was for pathways involved in IFN-γ signaling, defense response, antigen processing and presentation, and apoptotic process (Fig. 1C), revealing a predominant interferon (IFN)–mediated immune response in LP lesions. Therefore, we further assessed gene expression in our microarray data of type I, type II, and type III IFN family members, IFN receptors, and IFN response genes. As expected, IFNG, the sole type II IFN, and IFNGR1 and IFNGR2 were substantially increased in both LP and HLP samples, and IFN-induced genes (MX1 and OAS1) were all increased in LP/HLP skin lesions (Fig. 1, D and E). In contrast, none of the type I and type III IFNs were increased as the IFNG in LP/HLP skin lesions compared with healthy control skin (fig. S1, A and B). Immunofluorescence staining showed prominent IFN-γ in LP skin lesions and was predominantly colocalized with CD3 and CD8 (fig. S1C). Type I IFNs including IFN-α/β, and in particular IFN-κ, were also found to be increased in LP skin lesions compared with healthy skin (fig. S1D). Furthermore, the DEGs were enriched for IFN response genes, but not interleukin-4 (IL-4) or IL-17 response genes (Fig. 1F). These data were confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) demonstrating that IFNG and MX1, but not IL17A or IL22, were increased in LP/HLP skin lesions compared with control skin (Fig. 1G). Therefore, we conclude that IFN-γ is the dominant IFN in LP inflammation.

Fig. 1 Transcriptomic profiling of LP lesions reflects an IFN-γ-dominant inflammation.

(A) Principal components analysis of microarray data from skin lesions from LP (n = 20), HLP (n = 17), and healthy controls (n = 24). (B) The Venn diagram displays the intersection (upper panel) and correlation (lower panel) of DEGs (FDR, <0.1; FC, >1.5 or <−1.5) across the LP and HLP transcriptomes. The number of up-regulated and down-regulated genes for each dataset is reported in parentheses. (C) Graphs demonstrate the most highly enriched Gene Ontology categories in the transcriptomes of LP and HLP. (D and E) Expression of type II IFN, IFNG, and IFNGR (D), and the IFN response genes MX1, MX2, OAS1, and OASL (E) in the microarray data. (F) Further analysis and classification of DEGs in LP and HLP skin lesions to cytokine-induced genes. (G) qRT-PCR was used to detect the IFNG, MX1, IL17A, and IL22 expression in skin lesions of LP (n = 22), HLP (n = 16), and healthy controls (NC, n = 23). One-way ANOVA. Data are presented as the means ± SEM of measurements obtained in each sample. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. ns, not significant.

IFN-γ increases keratinocyte sensitivity to cell-mediated cytotoxicity

Keratinocyte apoptosis is a major characteristic of LP skin lesions (11). We therefore evaluated whether IFN-γ stimulation was associated with increased keratinocyte cell death. To address this, we used a culture system with healthy cells where keratinocytes from one individual were admixed with leukocytes from a different donor, leading to allogeneic killing of keratinocytes by T cells. Keratinocytes were primed with IFN-γ for 24 hours, medium was replaced, and then cocultured with CD3/CD28 preactivated peripheral blood mononuclear cells (PBMCs) from a healthy control (fig. S2A). Annexin V–propidium iodide (PI) flow cytometry demonstrated that keratinocytes pretreated with IFN-γ had increased cell death as measured by annexin V staining compared with those not pretreated with IFN-γ (Fig. 2A and fig. S2B), and this occurred in a dose-dependent manner (fig. S2C). Nonactivated PBMCs showed less cytotoxic activity against IFN-γ–induced keratinocytes than CD3/CD28-activated ones (PBMCs/keratinocytes, 10:1) (fig. S2C). Further, terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick end labeling (TUNEL) staining confirmed the flow cytometry findings (Fig. 2B). Priming with type I IFNs including IFN-α/β increased keratinocyte susceptibility to T cell–mediated cytotoxicity, but to a lesser extent than that observed with IFN-γ (fig. S2D). In contrast, when PBMCs were primed with IFN-γ for 24 hours before CD3/CD28 stimulation and coculture with keratinocytes, no increase in keratinocyte cell death was seen (Fig. 2C and fig. S2E).

Fig. 2 IFN-γ increases keratinocyte susceptibility to cell-mediated cytotoxicity.

(A) Keratinocytes from one donor were cocultured with CD3/CD28 microbead–activated PBMCs from a second donor (n = 2 pairs), and cell death was evaluated by annexin V–PI staining. The representative flow cytometry data (left panel) and summary (right panel) are shown. (B) TUNEL staining (red) was used to detect keratinocyte cell death; DAPI was used for nuclear staining (left panel; scale bar, 100 μm). Summary of TUNEL-positive cells. (C) PBMCs were primed with IFN-γ, treated with CD3/CD28 microbeads, and then added to unstimulated keratinocyte cultures. (D) CD3/CD28 microbead–activated PBMCs were preincubated with anti-CD4, anti-CD8, or anti-NKp44 blocking antibody for 1 hour, then added to the in vitro coculture model, and keratinocyte death was evaluated by annexin VPI staining. Data were analyzed using one-way ANOVA followed by Dunnett’s posttest. Data are presented as the means ± SD of measurements obtained in triplicate or quadruplicate experiments. *P < 0.05, **P < 0.01, ****P < 0.0001. KC, keratinocyte.

To determine the cell type responsible for the cytotoxicity in vitro, we used blocking antibodies against CD4, CD8, and NKp44. Blockade of CD8 led to an inhibition of keratinocyte cell death, whereas less inhibition was seen with CD4 blockade and no change with natural killer (NK) cell blockade (Fig. 2D). To characterize the nature of cell death in vitro, we assessed the expression of cleaved caspase 3, a protein marker of apoptosis, and two markers of necroptosis, phosphorylated receptor-interacting protein kinase 3 (p-RIP3) and phosphorylated mixed lineage kinase domain-like pseudokinase (p-MLKL) (fig. S3). These data showed mixed apoptotic (cleaved caspase 3 positive) and necroptotic responses (p-RIP3 and p-MLKL positive) in keratinocytes in our in vitro coculture system similar to what was seen in lesional LP skin ex vivo (fig. S4). These data indicate that IFN-γ is a critical cytokine promoting epidermal cell death in LP lesions through direct effect on keratinocytes and not through activation of infiltrating immune cells.

Cytotoxic responses to IFN-γ–primed keratinocytes are dependent on major histocompatibility complex class I

Cytotoxic T cell responses against cells are known to be dependent on major histocompatibility complex (MHC) antigen processing and presentation. We first analyzed the mRNA expression of MHC class I and II molecules from our microarray data of healthy, LP, and HLP skin and demonstrated that expression of all the major MHC class I and MHC class II molecules was increased in LP and HLP skin compared with healthy control skin (Fig. 3A). Immunofluorescence using pan–anti–MHC class I antibody showed that MHC class I molecules were highly expressed in LP epidermis compared with healthy skin. In contrast, MHC class II staining, using a pan–anti–MHC class II antibody, was localized to the upper dermis colocalizing on the inflammatory infiltrate along the epidermal-dermal junction. No MHC class II staining was seen in the epidermis of LP/HLP lesions. Furthermore, no staining for MHC class II was seen in healthy skin (Fig. 3B). To assess the role of IFN-γ in this process, we evaluated the gene expression of all MHC molecules in keratinocytes after IFN-γ stimulation and found that IFN-γ primarily up-regulated the mRNA expression of human leukocyte antigen A (HLA-A), HLA-C, and HLA-DR robustly in keratinocytes, but not HLA-B, HLA-DP, and HLA-DQ, which had very low expression level in both unstimulated and stimulated keratinocytes (Fig. 3C). Similarly, keratinocytes stimulated with type I IFNs such as IFN-α/β had increased expression of MHC I molecules, but to a lesser extent than with IFN-γ stimulation (fig. S5A). To address the role of MHC class I and class II responses, we blocked their function using MHC class I or MHC class II neutralizing antibodies in our model system. Treatment of IFN-γ–activated keratinocytes with a pan–anti–MHC class I blocking antibody completely inhibited cytotoxic activity toward keratinocytes. Anti–HLA-DR partially inhibited cytotoxic responses against keratinocytes, whereas other anti–MHC class II antibodies (HLA-DP/DQ) were inefficient (Fig. 3D and fig. S5B). Therefore, these data suggest that IFN-γ promotion of cytotoxicity in keratinocytes in LP is mainly through induction of MHC class I expression.

Fig. 3 Cytotoxic responses to IFN-γ–primed keratinocytes are MHC class I-dependent.

(A) The mRNA expression of all MHC molecules from the microarray data from LP (n = 20), HLP (n = 17), and healthy control skin (n = 24). (B) Representative immunofluorescence staining of MHC class I and MHC class II in LP/HLP lesions (n = 3) and controls (n = 3). DAPI was used to show nuclear staining (scale bar, 100 μm). (C) qRT-PCR measuring mRNA expression of MHC I and II molecules in keratinocytes stimulated with IFN-γ (10 ng/ml). (D) IFN-γ–primed keratinocytes were preincubated with anti–MHC class I or II monoclonal antibody for 1 hour and then cocultured with CD3/CD28-activated PBMCs. Statistical analysis was done using one-way ANOVA followed by Dunnett’s posttest. Data are presented as the means ± SD of measurements obtained in triplicate or quadruplicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

IFN-γ induces keratinocytes to express MHCs through JAK2/STAT1 signaling

To get a deeper understanding of the contribution of the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway to LP development, we performed literature-based network analysis of the genes regulated in the same direction in both LP/HLP lesions (FDR, <0.1; FC, >1.5 or <−1.5). This showed that highly connected nodes could be attributed to IFN signaling including JAK2 and STAT1 (Fig. 4A). STAT1 mRNA was the most highly expressed gene among all the STAT genes detected in our gene profile analysis (Fig. 4B). This was confirmed by measuring total and activated (phosphorylated) STAT1 protein, which was primarily observed in the epidermis of LP lesions, but not in healthy control skin (Fig. 4C), whereas STAT2 and phosphorylated STAT2 were mostly expressed in the inflammatory infiltrates (fig. S6A).

Fig. 4 IFN-γ signals through JAK2/STAT1 signaling in keratinocytes to induce MHC class I expression.

(A) Induced module network analysis of the DEGs shared by LP and HLP using literature-based networks (GePS). Node size correlates with the number of connected nodes and edges. Nodes with five connections are marked larger. (B) Expression of STAT1–6 in LP (n = 20), HLP (n = 17), and healthy control skin (NC) (n = 24) in our microarray data. (C) Representative immunofluorescence staining of STAT1 and p-STAT1 in LP/HLP skin lesions and controls (four samples were stained and analyzed per group). DAPI was used for nuclear staining (scale bar, 100 μm). (D) Keratinocytes were stimulated with IFN-γ (10 ng/ml) for an indicated time. Western blots for JAK1, JAK2, p-JAK1, p-JAK2, STAT1, STAT2, p-STAT1, and p-STAT2 are shown. (E) mRNA expression of MHC I molecules in JAK1, JAK2, STAT1, and STAT2 KO cells after 24 hours of IFN-γ (10 ng/ml) stimulation. One-way ANOVA. Data are presented as the means ± SD of measurements obtained in triplicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. WT, wild type.

IFN-γ signals through the JAK1/JAK2 and STAT1/STAT2 signal transduction pathway (12). To assess this pathway in keratinocytes, we examined the activation of JAK/STAT in response to IFN-γ stimulation. Western blotting of IFN-γ–stimulated keratinocytes showed that the expression of phosphorylated STAT1 (p-STAT1), p-STAT2, p-JAK1, and p-JAK2 were nearly undetectable at 0 min but increased over the time course (Fig. 4D and fig. S6B). Weak p-JAK1 was seen at 15 min, whereas JAK2 phosphorylation was more prominent and peaked at the 90-min time point. In contrast, STAT1 phosphorylation (p-STAT1) showed early and sustained activation after 15 min, whereas STAT2 phosphorylation (p-STAT2) was weaker and only detectable after 60 min (Fig. 4D and fig. S6B).

To examine the role of JAK/STAT signaling in regulating MHC class I expression in keratinocytes, we used the JAK1, JAK2, STAT1, and STAT2 CRISPR-Cas9 plasmids to knock out (KO) each member of the JAK/STAT signaling machinery involved in IFN-γ responses (fig. S7A). Absence of the targeted protein was verified by Western blotting (fig. S7B). KO of JAK2 or STAT1 substantially inhibited the induction of MHC class I (HLA-A/B/C) in keratinocytes in response to IFN-γ stimulation compared with control keratinocytes (Fig. 4E). In contrast, minimal suppression of MHC class I expression was seen in JAK1 or STAT2 KO lines (Fig. 4E). In addition, the mRNA abundance of IFN-γ–responsive genes such as MX1, OASL, IRF7, and IRF9 was also decreased in JAK2 and STAT1 KO keratinocytes (fig. S6C). In summary, these observations demonstrate that IFN-γ induction of MHC class I expression in keratinocytes is largely JAK2/STAT1-dependent.

Targeting JAK signaling protects keratinocytes from cytotoxic responses

Next, we used JAK2 or STAT1 KO keratinocytes in our model system to verify the roles of JAK2/ STAT1 signaling in priming keratinocytes for cytotoxic responses in LP. This approach demonstrated that JAK2 or STAT1 KOs successfully protected IFN-γ–induced keratinocytes from cell-mediated cytotoxic responses (Fig. 5A). JAK1 and STAT2 KO demonstrated decreased cell-mediated cytotoxicity but much less than JAK2 or STAT1 KO did (fig. S8A).

Fig. 5 Targeting JAK signaling protects keratinocytes from cell-mediated cytotoxicity.

(A) JAK2 and STAT1 KO cells were primed with IFN-γ and cocultured with CD3/CD28-activated PBMCs. Keratinocyte cell death was evaluated for annexin V positivity by flow cytometry. (B) The representative flow cytometry data and analysis of keratinocyte cell death in the coculture model with or without baricitinib. (C) mRNA expression of MHC I molecules in IFN-γ–induced keratinocytes with or without baricitinib (10 μM) for 24 hours. One-way ANOVA. Data are presented as the means ± SD of measurements obtained in triplicate or quadruplicate experiments. *P < 0.05, ****P < 0.0001.

To assess for enriched drug targets among the genes differentially expressed in LP, we performed a drug target enrichment analysis as previously described by our group (13). Top predicted drug targets included the JAK inhibitor tofacitinib (FDR, P = 5.4 × 10−15), methylprednisolone (FDR, P = 3.7 × 10−10), and chloroquine (FDR, P = 1.6 × 10−8) (table S2).

To further investigate the therapeutic potential of JAK blockade in LP, we used baricitinib. Baricitinib was selected instead of tofacitinib because it is more selective for JAK1 and JAK2 in contrast to tofacitinib, which is selective for JAK1 and JAK3 (14). IFN-γ–primed keratinocytes were treated with baricitinib during the IFN-γ priming (first 24 hours) and during the 72-hour coculture of keratinocytes and PBMCs. Baricitinib-treated keratinocytes were completely resistant to cell-mediated cytotoxicity (Fig. 5B), and up-regulation of MHC class I was inhibited by baricitinib in IFN-γ–activated keratinocytes, as demonstrated by qRT-PCR (Fig. 5C). Consistent with the qRT-PCR results, the Western blot showed that the high-protein expression of MHC class I induced by IFN-γ treatment for 24 hours was substantially inhibited by baricitinib (fig. S8B). Together, these data suggest that drugs targeting JAK2/STAT1 signaling should be assessed for the treatment of LP.

High IFN-γ responses characterize diseases with prominent epidermal cell death

Diseases characterized by interface dermatitis, such as LP, lupus erythematosus, graft-versus-host disease (GVHD), and Stevens-Johnson syndrome (SJS), share similar histopathological characteristics including keratinocyte apoptosis and inflammatory cell infiltration close to the basal membrane (15). However, it is unknown whether a common immune mechanism characterizes this type of inflammatory response in the skin. Thus, we investigated the overlap of diseases with interface dermatitis, including LP and lupus erythematosus, and compared against disease such as psoriasis, a T cell–dominant inflammatory disorder that lacks epidermal apoptosis. As shown by TUNEL staining assay, keratinocyte cell death in the epidermis was observed in skin lesions of LP and cutaneous lupus erythematosus (CLE), but not in psoriasis vulgaris (PV) and healthy controls (NC) (Fig. 6A). To assess the nature of cell death in skin lesions of inflammatory diseases including LP and CLE, we performed tissue immunofluorescence demonstrating that the epidermal keratinocytes in LP and CLE skin lesions were mostly cleaved caspase 3 positive compared with no staining for cleaved caspase 3 in epidermis of PV or healthy skin. Moreover, both LP and CLE had positive staining for both p-RIP3 and p-MLKL (fig. S9). This suggests that features of both apoptosis and necroptosis are seen in the epidermis of LP and CLE, inflammatory dermatoses characterized by interface dermatitis.

Fig. 6 Diseases with prominent epidermal cell death are characterized by high IFN-γ responses.

(A) Representative TUNEL staining showing cell death in skin lesions of LP, CLE, psoriasis, and healthy controls. DAPI was used for nuclear staining (scale bar, 100 μm). (B) mRNA expression of IFNG and MHC I molecules in chronic plaque psoriasis (PV) (n = 12 and n = 7 for IFNG and MHC I, respectively), LP (n = 38 and n = 10 for IFNG and MHC I, respectively), CLE (n = 21 and n = 12 for IFNG and MHC I, respectively) skin lesions, and healthy control skin (NC; n = 11 and n = 15 for IFNG and MHC I, respectively). One-way ANOVA. Data are presented as the means ± SD of measurements obtained in each sample. (C) Representative immunofluorescence staining of MHC I and MHC II, STAT1, and p-STAT1 in PV and CLE skin lesions and healthy controls. The staining was performed on more than three patient samples for each group. DAPI was used to highlight nuclear staining (scale bar, 100 μm).

Moreover, our qRT-PCR analysis demonstrated that the mRNA expression of IFNG and MHC I transcripts was much higher in LP and CLE than that in control or PV skin (Fig. 6B), which was also validated by Western blot (fig. S8C). Immunofluorescence staining for MHC molecules showed higher expression of MHC I in CLE compared with psoriasis or healthy control skin (Fig. 6C). Furthermore, STAT1 and p-STAT1 were all markedly observed in the epidermis of CLE, which was similar with the expression pattern of LP (Fig. 6C). Together, these data show that inflammatory skin diseases characterized by interface responses share similar central IFN-γ immunological mechanisms.

DISCUSSION

Here, we have described the global transcriptomic changes in LP and its variant HLP and identified IFN-γ as a dominant inflammatory pathway in its pathogenesis. We demonstrate that IFN-γ may play a major role in priming keratinocytes toward CD8+ T cell–mediated cytotoxic cellular responses, which is a characteristic of LP lesions, through induction of MHC I expression. We further show the importance of JAK2/STAT1 signaling in this process and demonstrate that JAK inhibition hinders these responses and is a potential therapeutic option for the treatment of LP. Furthermore, we demonstrate that heightened IFN-γ expression and activity is a common feature for diseases characterized by an interface inflammatory reaction, broadening the implications of our findings.

The sole type II IFN, IFN-γ, has a critical role in both innate and adaptive immunity and has a wide range of proinflammatory effects. It enhances expression of the chemokines CXCL9/10/11 to promote T cell infiltration (16). Furthermore, IFN-γ is an important activator of macrophages (17) and an inducer of MHC class II expression (18). IFN-γ can also mediate MHC class I antigen presentation in epithelia (19) and was recently proposed as a critical driver of keratinocyte death in LP (2022). In addition, polymorphisms in the IFNG gene have been shown to be associated with oral LP (23). However, the mechanism involved in IFN-γ–driven pathogenicity has remained unclear.

LP is characterized by a cytotoxic immune response against keratinocytes of the basal layer, an immune response pattern not observed in psoriasis and atopic dermatitis (24). The etiology of LP is unclear, but many investigators consider LP to be an autoimmune disease (25, 26), particularly on the basis of its association with HLA-DR (27, 28). In addition, several reports have suggested that intracellular bacteria (29) or infected human papillomavirus (30) might be the source of such antigens. Although our data are consistent with LP being driven by T cell responses against a specific or limited set of antigens, our findings do not address the nature of this antigen.

Several clinical variants of LP are known, but the most common ones are LP and oral lichen planus, which can be a debilitating disease with extensive erosions in the mouth and esophagus (1). HLP is a subtype of LP and characterized by marked hyperkeratosis, which is consistent with what we see in our transcriptomic analysis where HLP had greater enrichment for processes such as keratinization, but otherwise exhibited near identical features. Despite the well-known clinical manifestations of LP, the immune pathogenesis of this disease remains mostly unknown. One of the more characteristic features of LP is the dense T cell infiltration along the dermal-epidermal junction of the skin often obscuring the boundary between the dermis and the epidermis. This inflammatory pattern is not restricted to LP but is also found in other skin diseases where it is typically accompanied by mild to sometimes marked epidermal cytotoxic cell death. This includes diseases such as cutaneous lupus (31), GVHD (32), and drug reactions such as SJS (33).

Despite extensive investigation, the mechanisms involved in the interface inflammatory reaction have not been elucidated. It has been reported that T cells from LP lesions are more cytotoxic against autologous lesional keratinocytes than T cells from adjacent clinically healthy skin, and this could be partially blocked with anti–MHC class I antibody (34). Furthermore, obvious accumulation of Langerhans cells and T cells, particularly of CD4+ and CD8+ subsets, is found in both epidermis and dermis of LP lesions compared with nonlesional and healthy skin (35, 36). CXCR3+ cytotoxic T cells that can be attracted by CXCL9 and CXCL10 are reported as the major effector cells that are located in the junctional zone of LP (37, 38). CD4+ T cells may be activated by MHC class II–positive cells in the junctional zone, further activating cytotoxic CD8+ T cells against epidermal keratinocytes (9). This could involve CD8+ T cells recognizing antigens associated with MHC class I molecules and subsequently triggering keratinocyte apoptosis via the perforin/granzyme pathway or the Fas/FasL pathway (36).

The manner of cell death of epidermal keratinocytes in these skin diseases is under debate. It is universally recognized that destruction of basal keratinocytes is due to apoptosis in LP (22, 39, 40). However, one study revealed that both cleaved caspase 3–positive cells, indicative of apoptosis, and p-RIP3–positive cells, consistent with necroptosis, can be observed in LP and CLE epidermis (20). Our findings are consistent with these observations with positive staining for markers of both apoptosis, as defined by the presence of cleaved caspase 3 in the epidermis, and markers of necroptosis, including p-RIP3, and p-MLKL positivity in epidermal keratinocytes, suggesting that both of these cell death mechanisms contribute to inflammation in LP and possibly a wide range of skin diseases (41).

On the basis of the above observations, MHC class I and II molecules, which are both overexpressed in LP lesions, may contribute to its pathogenesis. It has been reported that the expression of HLA-DR, but not HLA-DP or HLA-DQ, by keratinocytes in LP may be induced by the lymphocytic infiltrates (28). We were unable to confirm these observations but found instead MHC class II molecules to be predominantly localized to the inflammatory infiltrate. In our study, we observe that blocking HLA-DR, but not HLA-DP or HLA-DQ, partially prevents keratinocyte cell death in our model system, which is of interest as polymorphisms in HLA-DR are closely associated with LP in several populations (27, 28). In contrast to MHC class II, MHC class I blockade showed a much greater inhibitory effect on T cell–mediated keratinocyte cell death, suggesting involvement of antigen presentation through MHC class I and involvement of CD8+ T cells. This is consistent with our findings, given the strong induction of MHC class I by IFN-γ in keratinocytes in vivo and the markedly increased expression of MHC class I molecules in LP epidermis. Besides increasing MHC class I molecules, IFN-γ is likely to also contribute by enhancing the activity of the antigen-processing machinery in keratinocytes (19, 42).

Our data demonstrate the discordant role of JAK1 and JAK2 in the regulation of MHC class I expression in keratinocytes. Whereas JAK1 KO had minimal to no effect on MHC class I expression, JAK2 KO had a more marked effect on suppressing, although not completely inhibiting, the effect of IFN-γ on MHC class I expression. In contrast, there was an absolute requirement for STAT1 for MHC class I expression, whereas there was a minimal effect of STAT2 KO. This matches the data from Western blotting showing robust and sustained activation of JAK2/STAT1, but not JAK1/STAT2, in keratinocytes. These data demonstrate the relative importance of the two JAKs and two STATs in IFN type II responses, which is likely to have implications with the use of future and more selective JAK inhibitors for inflammatory skin disorders.

Currently, there are no FDA-approved medications for the treatment of LP. Our observations support the use of JAK inhibitors for LP and, possibly, other diseases characterized by interface reaction. The JAK/STAT pathway is downstream of the IFN-γ receptor, and small molecules that inhibit JAKs can reduce IFN-γ–induced immunoreactions (43). Our drug prediction analysis identified tofacitinib, a selective JAK1/JAK3 inhibitor, as the top therapeutic agent based on differential gene expression in LP skin. Several JAK inhibitors are currently available, but drug targeting information on these is still fairly limited. Given the dependency of IFN-γ on JAK1/JAK2 signaling, we selected baricitinib, an oral and reversible inhibitor specific to JAK1 and JAK2, as the drug of choice to test in our model system. Baricitinib was recently approved by the FDA for the treatment of moderately to severely active rheumatoid arthritis in adults (44) and has a favorable safety profile (45, 46). Baricitinib is a promising treatment for a wide range of dermatologic diseases, based on evidence from ongoing clinical trials, including SLE (47), psoriasis (48), atopic dermatitis (49), alopecia areata (50), and GVHD (51). Our data further indicate that baricitinib may become a promising biological treatment for LP and other diseases characterized by interface reaction, and a clinical trial using JAK inhibitors in this setting is warranted. We acknowledge that this study did not address the clinical efficacy of baricitinib or other JAK1/2 inhibitors in patients with LP.

One limitation of this work is the lack of an autologous in vitro system to test responses of T cells against keratinocytes. However, this is difficult in execution for several reasons, including challenges in recruiting untreated patients for extensive skin sampling, the inhibitory effect of IFN-γ on cell growth, for immunological studies. However, our observations are in agreement with a previous study looking at the in vitro cytotoxic activity of T cell clones from patients with LP against immortalized autologous epidermal keratinocytes, where cytotoxicity was dependent on CD8+ T cells (34).

In conclusion, our findings support targeting IFN-γ or its downstream signaling as a therapeutic strategy for LP. In addition, we provide evidence that diseases characterized by the interface inflammatory reaction may use IFN-γ as a common pathway, and therefore, the implications of our findings could apply to a wide range of inflammatory skin diseases.

MATERIALS AND METHODS

Study design

The aim of this study was to identify the critical immune processes in LP pathogenesis and identify novel therapeutic targets. The first objective was illustrated by microarray profiling performed on skin biopsy samples demonstrating that IFN-γ and IFN-γ–regulated genes were enriched in the LP skin transcriptome, and by a cell coculture model showing that IFN-γ increased keratinocytes susceptibility to CD8+ T cell–mediated cytotoxicity. The second objective was investigated by in vitro cell coculture model studies using CRISPR-Cas9 KO cells and JAK inhibitor baricitinib.

The microarray profiling experiment was carried out on RNA extracted from paraffin-embedded skin biopsy samples obtained from patients with LP (n = 20), HLP (n = 17), and healthy controls (n = 24). TUNEL staining images were quantified in a blinded fashion. Details of the sample number and experimental replicates are provided in each figure legend. Primary data are reported in data file S1.

Human subjects

The study protocol was approved by the Institutional Review Board of the University of Michigan Medical School, and the study was carried out in accordance with the Declaration of Helsinki principles. All patients and controls gave written, informed consent. Patients with LP had both clinical and pathologic confirmation of diagnosis. Demographic information of patient and healthy controls is provided in table S3. Healthy controls were recruited by advertisement.

Microarray analysis of skin lesions

Biopsies of LP and HLP cases were identified through the University of Michigan Pathology Database. Control blocks were obtained from healthy volunteers. Patients who met both clinical and histologic criteria for LP or HLP were included in the study. Validation of clinical and pathologic LP diagnosis was made via a review of dermatology notes for each case. RNA was isolated from 10-μm sections of formalin-fixed paraffin-embedded blocks of identified skin biopsies. RNA was extracted using the E.Z.N.A. FFPE RNA Kit (Omega Bio-tek). Complementary DNA (cDNA) was prepared and biotinylated using the NuGEN Encore Biotin Module (Encore Biotin Module Manual, P/N M01111 v6). Labeled cDNA was hybridized at 48°C to Affymetrix Human Gene ST 2.1 array plates, which were then washed, stained, and scanned using the Affymetrix GeneTitan system (software version 3.2.4.1515) with the assistance of the University of Michigan DNA Sequencing Core. Quality control and RMA (robust multi-array average) 23 normalization of CEL files were performed in R software version 3.1.3 using custom CDF version 19 and modified Affymetrix_1.44.1 package from BrainArray (http://brainarray.mbni.med.umich.edu/Brainarray/Database/CustomCDF/genomic_curated_CDF.asp). Log2 expression values were batch corrected using Combat implemented into GenePattern (www.broadinstitute.org/cancer/software/genepattern/). The baseline expression was defined as minimum plus one SD of the median of all genes. A variance filter of 80% was then applied. Literature pathway network analysis was performed using the Genomatix Pathway System (GePS) (www.genomatix.de). A transcriptional network from the genes differentially regulated (FDR, <0.1; FC, >1.5 or <−1.5) as defined by our filter criteria was generated using the literature-based GePS software (www.genomatix.de). GePS allows visualization of dependencies among genes in pathways, networks, and processes derived from literature-based knowledge and genome-wide sequence analysis. We applied a function-word filter, meaning that to be displayed in the transcriptional network, two genes have to be co-cited in the same sentence with a function word (e.g., gene A activates gene B).

Drug target enrichment analysis

We conducted the drug target enrichment analysis among the DEGs using an algorithm we described previously (13). We compiled the drug-gene relationships by combining interaction data from the Comparative Toxicogenomics Database (52), DrugBank (53), and PharmGKB (54). We only used the drug targets expressed in our data and removed drugs targeting more than 100 genes. We then used a hypergeometric test to examine the statistical enrichment for differential genes among each drug’s targets. An FDR ≤5% and an observed/expected ratio ≥2 were used as criteria to nominate candidate drugs that have at least five drug targets overlapping with the DGE list.

RNA extraction and qRT-PCR

RNA was isolated from cells using the QIAGEN RNeasy Plus Kit. qRT-PCR was performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems) with TaqMan Universal PCR Master Mix (4304437, Thermo Fisher Scientific). Primers (Thermo Fisher Scientific) used in this study were as follows: HLA-A, Hs01058806_g1; HLA-B, Hs00818803_g1; HLA-C, Hs00740298_g1; HLA-DPA1, Hs00410276_m1; HLA-DPB1, Hs03045105_m1; HLA-DQA1, Hs03007426_mH; HLA-DQB1, Hs03054971_m1; HLA-DRA, Hs00219575_m1; MX1, Hs00895608_m1; OASL, Hs00984387_m1; IRF7, Hs01014809_g1; IRF9, Hs00196051_m1; RPLP0, Hs00420895_gH.

Cell culture and stimulation

N/telomerase reverse transcriptases (TERTs), an immortalized human keratinocyte line (55), was grown in Keratinocyte-SFM medium (17005-042, Thermo Fisher Scientific) supplemented with bovine pituitary extract (30 μg/ml), epidermal growth factor (0.2 ng/ml), and 0.3 mM calcium chloride. Cells at proper confluency were subsequently treated with recombinant human IFN-γ (10 ng/ml; R&D Systems), IFN-α (20 ng/ml; I4276, Sigma), and IFN-β (10 ng/ml; 8499-IF-010, R&D Systems) for an indicated time before RNA and protein extraction.

Isolation of PBMCs

PBMCs were obtained from healthy volunteers after obtaining informed consent. In short, the blood samples were diluted with 1× Hank’s buffer at 1:1 and underlaid with Histopaque-1077 (10771, Sigma). The tube was centrifuged at 800g for 20 min, the lymphocyte interphase was carefully aspirated, collected, and washed with Hank’s buffer twice and centrifugated at 800g for 5 min, and the cells were resuspended in Keratinocyte-SFM medium and added to the cell coculture model.

Coculture model of keratinocytes and PBMCs

PBMCs were cultured with/without CD3/CD28 microbeads for 72 hours (1 ml of CD3/CD28 microbeads for 1 × 108 PBMCs; 130-091-441, Miltenyi Biotec). Upon reaching semiconfluence, N/TERT cells (about 5 × 104 per well) in 12-well plates were washed and stimulated with IFN-γ (10 ng/ml), IFN-α (20 ng/ml), or IFN-β (10 ng/ml) for the first 24 hours, followed by replacing the medium with 1 ml of cultured PBMCs (5 × 105/ml). After the coculture, N/TERT cells were then washed twice with phosphate-buffered saline (PBS) and collected for flow cytometry annexin V–PI analysis or TUNEL staining for cell death. To block the functions of immune cells, isolated PBMCs were incubated with blocking antibodies targeting CD4 (1:100; 300516, BioLegend), CD8 (1:3000; GTX19718, GeneTex), or NKp44 (1:100; 325104, BioLegend) for 1 hour and then added together in the coculture model for 72 hours. In other blocking experiments, the anti–HLA-A/B/C (LS-C190912, LifeSpan BioSciences), HLA-DP (ab20897, Abcam), HLA-DQ (ab23632), and HLA-DR (ab136320) neutralizing antibody at 10 μg/ml or mouse immunoglobulin G (IgG) isotype control (LS-C88574, LifeSpan BioSciences) was added together with PBMCs and remained in the coculture model for 72 hours. To inhibit the JAK signaling pathway in keratinocytes, 10 μM baricitinib (1187594-09-7, Sigma) was also added in the coculture model 24 hours before IFN-γ treatment and maintained throughout the coculture experiments.

Annexin V–PI

Apoptotic cells were detected by staining with fluorescein isothiocyanate–labeled annexin V and PI (BD Pharmingen) according to the manufacturer’s instructions. The data were statistically analyzed by FlowJo v10.

Generation of KO keratinocytes by CRISPR-Cas9

Guide RNAs were developed using a web interface for CRISPR design (http://crispr.mit.edu). The pSpCas9 (BB)-2A-GFP (PX458) (48138, Addgene) was used as cloning backbone. The details about target sequences and scores of the single-guide RNA (sgRNA) were as follows: JAK1, TGATCTTCTATCTGTCGGAC (score, 91); JAK2, CATTTCTGTCATCGTAAGGC (score, 90); STAT1, ATTGGGCGGCCCCCCAATAC (score, 93); and STAT2, TGGCAGCAGTAGCTCGATTA (score, 92). We followed the CRISPR-Cas9 protocol as we previously published (56). The chromatograms for the KO cell lines are provided in fig. S7A.

Immunostaining

Formalin-fixed, paraffin-embedded tissue slides obtained from patients with LP, lupus, psoriasis, and healthy controls were heated for 30 min at 60°C, rehydrated, and epitope retrieved with tris-EDTA (pH 6). Slides were blocked and incubated with primary antibodies against STAT1 (9172), STAT2 (4594), p-STAT1 (9167), and p-STAT2 (4441) (all from Cell Signaling Technology), and MHC I (M00194-1, BosterBio), MHC II (ab157210, Abcam), IFN-α (LS-C390384, LifeSpan BioSciences), IFN-β (PA5-20390, Invitrogen Antibodies), CD4 (300516, BioLegend), CD3 (ab17143), CD8 (ab199016), IFN-γ (ab9657), cleaved caspase 3 (ab13847), p-RIP3 (ab209384), p-MLKL (ab187091) (all from Abcam), and rabbit IgG isotype control (LS-C149375, LifeSpan BioSciences) overnight at 4°C. Slides were incubated with biotinylated secondary antibodies (biotinylated goat anti-rabbit IgG antibody, BA1000, Vector Laboratories; biotinylated horse anti-mouse IgG antibody, BA2000, Vector Laboratories) and then incubated with fluorochrome-conjugated streptavidin. Slides were prepared in mounting medium with 4′,6-diamidino-2-phenylindole (DAPI) (VECTASHIELD Antifade Mounting Medium with DAPI, H-1200, VECTOR). Images were acquired using a Zeiss Axioskop 2 microscope and analyzed by the SPOT software 5.1. Images presented are representative of at least three biologic replicates.

TUNEL assays

For TUNEL staining of cells, keratinocytes that were cocultured with activated PBMCs were washed gently with PBS three times and then fixed with 4% paraformaldehyde and permeabilized with 0.1% sodium citrate and 0.1% Triton X. DNA fragmentation was determined by TUNEL (12156792910, Roche Applied Science) as described by the manufacturer. Percent TUNEL+ cells were quantified using CellC (TUNEL-positive cells calculated as ratio against DAPI-positive cells).

For skin biopsies, TUNEL staining was performed according to the manufacturer’s protocol. In short, paraffin-embedded skin slides were dewaxed and rehydrated according to standard protocol and then treated with proteinase K solution. Slides were then treated with TUNEL reaction mixture in a humidified chamber followed by PBS washing. Then, slides were mounted by DAPI. Images were acquired using a Zeiss Axioskop 2 microscope and analyzed by SPOT software V.5.1. Images presented are representative of three experiments.

Western blot

Total protein was isolated from cells using Pierce radioimmunoprecipitation assay buffer (89900, Thermo Fisher Scientific) with PMSF (phenylmethylsulfonyl fluoride) Protease Inhibitor (36978, Sigma) and PhosSTOP (04906845001, Roche) and run on precast gel (456-1094S, Bio-Rad). Proteins were transferred to polyvinylidene difluoride membranes, blocked with 3% BSA, then probed by primary antibodies including anti-STAT1 (9172), STAT2 (4594), p-STAT1 (9167), p-STAT2 (4441), JAK1 (3344T), JAK2 (3230T), p-JAK1(74129), p-JAK2 (4406T) (all from Cell Signaling Technology), and β-actin (A5441, Sigma), followed by secondary antibodies [anti-mouse or rabbit IgG, AP (alkaline phosphatase)–linked antibody, Cell Signaling Technology], washed three times, and then enhanced chemifluorescence (ECF) substrate was added (RPN5785, GE Healthcare). Membrane was scanned on a Molecular Dynamics STORM 860 PhosphorImager (GE Health Care, STORM 860).

Statistical analysis

Data obtained from at least three independent experiments were analyzed using GraphPad Prism software version 6 (GraphPad software). Statistical significance was determined using Student’s unpaired two-tailed t test or analysis of variance (ANOVA) as indicated in the legend (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). Flow cytometry data were analyzed using FlowJo v10. The number of sampled units, n, is indicated in the figure legends. For microarray, FDR was used to control the multiple testing.

SUPPLEMENTARY MATERIALS

stm.sciencemag.org/cgi/content/full/11/511/eaav7561/DC1

Fig. S1. Transcriptomic profiling analysis and tissue immunofluorescence of IFN expressions in LP/HLP lesions.

Fig. S2. IFN-γ increases keratinocyte susceptibility to cell-mediated cytotoxicity.

Fig. S3. Keratinocyte death in in vitro coculture system is mediated by apoptosis and necroptosis.

Fig. S4. Epidermal keratinocyte death in LP skin lesions is both apoptosis and necroptosis.

Fig. S5. Cytotoxic responses to IFN-γ–primed keratinocytes are MHC class I-dependent.

Fig. S6. IFN-γ induces keratinocytes to express MHCs through JAK2/STAT1 signaling.

Fig. S7. Chromatograms and validation for JAK1, JAK2, STAT1, and STAT2 KO cell lines.

Fig. S8. Targeting JAK signaling protects keratinocytes from cell-mediated cytotoxicity.

Fig. S9. Epidermal keratinocyte death in CLE and LP, but not psoriasis (PV), is characterized by both apoptosis and necroptosis.

Table S1. The list of DEGs based on microarray data in skin lesions.

Table S2. Drug target enrichment analysis among the genes differentially expressed in LP.

Table S3. Skin donor demographics.

Data file S1. Primary data

REFERENCES AND NOTES

Acknowledgments: We thank our staff in the clinic and pathology for help with identifying and locating histological samples of LP and other inflammatory skin diseases. Funding: This work was supported by the Taubman Institute Innovation Project program (to J.E.G. and J.M.K.), the Babcock Endowment Fund (L.C.T., M.K.S., J.E.G.), the National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS): AR060802 (J.E.G.) and AR072129 (L.C.T.), the National Psoriasis Foundation Translational Grant (M.K.S.), the National Institute of Allergy and Infectious Diseases (NIAID) under award numbers R01-AR06 (J.E.G.) and P30 AR075043 (J.E.G.), the A. Alfred Taubman Medical Research Institute Kenneth and Frances Eisenberg Emerging Scholar Award (J.E.G.), and the Parfet Emerging Scholar Award (J.M.K.). L.C.T. is supported by the Dermatology Foundation, Arthritis National Research Foundation, and National Psoriasis Foundation. Author contributions: Experiments and processing of samples: S.S., L.C.T., M.K.S., X.X., K.X., R.U., C.C.B., C.Z., M.P., A.C.B., J.F., M.A.B., B.P.-W., A.C., and S.G.; bioinformatics analyses: L.C.T., M.P., and C.C.B.; design of the study and writing of the manuscript: J.J.V., S.C., P.H., J.M.K., J.E.G., S.S., and L.C.T. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data associated with this study are present in the paper or the Supplementary Materials. Deposition of microarray data on GEO (accession number: GSE130403).
View Abstract

Stay Connected to Science Translational Medicine

Navigate This Article