Research ArticleFibrosis

Epigenetic activation and memory at a TGFB2 enhancer in systemic sclerosis

See allHide authors and affiliations

Science Translational Medicine  19 Jun 2019:
Vol. 11, Issue 497, eaaw0790
DOI: 10.1126/scitranslmed.aaw0790

An epigenetic sclerotic lock

Systemic sclerosis (SSc) is an autoimmune disease resulting in progressive fibrosis of connective tissue for which few therapies are available. Shin et al. found an enhancer whose epigenetic activation led to sustained up-regulation of TGFB2, but not other isoforms of TGFB, in fibroblasts from patients with diffuse SSc. Constitutive activation of TGFβ2 signaling in patient fibroblasts resulted from NF-κB and BRD4 occupancy at the enhancer. Accordingly, treatment with the bromodomain inhibitor JQ1 repressed collagen synthesis and reversed fibrosis in patient skin explants. TGFβ2 signaling may thus be a key, potentially targetable mechanism of fibrosis in some patients with diffuse SSc.

Abstract

In systemic sclerosis (SSc), previously healthy adults develop an inflammatory prodrome with subsequent progressive fibrosis of the skin and viscera. SSc has a weak signature for genetic contribution, and there are few pathogenic insights or targeted treatments for this condition. Here, chromatin accessibility and transcriptome profiling coupled with targeted epigenetic editing revealed constitutive activation of a previously unannotated transforming growth factor–β2 (TGFB2) enhancer maintained through epigenetic memory in SSc. The resulting autocrine TGFβ2 signaling enforced a profibrotic synthetic state in ex vivo fibroblasts from patients with SSc. Inhibition of NF-κB or BRD4 achieved sustained inhibition of TGFB2 enhancer activity, mitigated profibrotic gene expression, and reversed dermal fibrosis in patient skin explants. These findings suggest a potential epigenetic mechanism of fibrosis in SSc and inform a regulatory mechanism of TGFB2, a major profibrotic cytokine.

INTRODUCTION

Systemic sclerosis (SSc) is a rare and complex disorder in which previously healthy young adults show intractable fibrosis of the skin and internal organs (1, 2). This complex disease associates with an overt inflammatory prodrome, but it is unclear whether this is a marker or driver of the disease. Although SSc is among the most devastating rheumatic diseases with a 10-year mortality rate approximating 30% (3, 4), its pathogenic mechanism remains unknown, and treatments are largely symptomatic and often ineffective.

The transforming growth factor–β (TGFβ) family of cytokines is a dominant regulator of both physiologic and pathologic collagen synthesis and deposition in the extracellular matrix (5, 6). TGFβ has been directly implicated in the differentiation of invasive and synthetic myofibroblasts from a variety of progenitor cell types and for the initiation and maintenance of transcriptional programs intrinsic to fibrosis. Lesional skin from patients with SSc shows a signature for high TGFβ signaling that is sustained in isolated dermal fibroblasts maintained in culture (710). The mechanism of enforced TGFβ signaling in SSc, however, remains unknown. Obstacles to progress include the lack of a major defined genetic contribution to the condition, resulting in a lack of animal models that faithfully recapitulate the predisposition for and pathogenesis of human disease. Familial recurrence of SSc is exceedingly rare, and although the susceptibility loci identified by genome-wide association studies are broadly indicative of a general autoinflammatory tendency, they are not specific for SSc (11). Moreover, twin studies have shown minimal heritability for SSc (12). In the absence of a major genetic determinant, it is unclear how SSc fibroblasts sustain elevated TGFβ signaling. A possible explanation for the maintenance of a fibrotic synthetic repertoire in cultured SSc fibroblasts might be the integration of more subtle genetic and environmental influences into a stable predisposing epigenetic state (12). To investigate a potential epigenetic mechanism of SSc, we applied a variety of complementary discovery-based approaches to profile and functionally interrogate primary tissue and cells from patients with this condition.

RESULTS

Autocrine TGFβ2 signaling “locks” ex vivo SSc fibroblasts into a profibrotic state

RNA-sequencing (RNA-seq) analysis revealed that primary dermal fibroblasts derived from lesional skin of patients with diffuse SSc (hereafter called SSc fibroblasts; n = 6) showed concordant and stable expression differences when compared to control fibroblasts isolated from healthy donors (n = 5). SSc fibroblasts maintained high expression of genes associated with extracellular matrix organization and TGFβ signaling (Fig. 1A and fig. S1). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) confirmed the elevated expression of profibrotic genes, such as type 1 collagen (COL1A1) and the collagen-specific chaperone SERPINH1, in patient-derived primary fibroblast lines (Fig. 1B). SSc fibroblasts also showed elevated mRNA and protein expression of TGFβ2 (but not β1 or β3) (Fig. 1, B and C). Inhibition of RNA transcription by actinomycin D normalized TGFB2 mRNA expression in SSc fibroblasts, indicating that the heightened amount of TGFB2 mRNA in SSc fibroblasts related to increased transcription (fig. S2). The equivalent expression of the myofibroblast differentiation marker smooth muscle actin (ACTA2) in control and SSc fibroblasts indicated that gene expression changes in SSc fibroblasts reflected differences in the performance of comparable cell types, rather than a transition to myofibroblasts in SSc (Fig. 1B). We observed no differences in gene expression between control fibroblasts and fibroblasts derived from nonlesional skin of patients with SSc (fig. S3). We detected specific up-regulation of TGFB2 mRNA expression in vivo by RT-qPCR of homogenized lesional skin biopsies (Fig. 1D) and in situ mRNA hybridization of sectioned lesional biopsies from patients with diffuse SSc (Fig. 1E and figs. S4 and S5). Together, these data document that patient fibroblasts from lesional skin actively maintain profibrotic gene expression and transcriptional up-regulation of TGFB2 ex vivo.

Fig. 1 Patient-derived SSc fibroblasts maintain a fibrotic synthetic repertoire ex vivo.

(A) Heat map of genes differentially expressed (rows) between healthy control and lesional SSc fibroblasts by RNA-seq [n = 3 biological replicates, false discovery rate (FDR) < 0.05]. (B and C) mRNA and protein expression in control and SSc fibroblast lines. (D) mRNA expression in homogenized biopsies taken from diffuse SSc lesional skin (n = 5) versus healthy control skin (n = 4). (E) TGFB2 mRNA expression (green) measured by mRNA in situ hybridization of healthy control skin and lesional SSc skin sections (n = 4). Arrowheads indicate cells with high TGFB2 expression. Scale bars, 20 μm. DAPI, 4′,6-diamidino-2-phenylindole. (F and G) mRNA expression upon stimulation of fibroblasts with exogenous TGFβ2 ligand. (H) TGFB ligand and TGFβ target gene expression upon siRNA knockdown of TGFB2 in primary fibroblasts. *P < 0.05, **P < 0.01, and ***P < 0.001. ncontrol = 5 and nSSc = 6. Two-way Student’s t test for single comparisons or one-factor analysis of variance (ANOVA) with FDR correction for all experiments, except (A) and (D) TGFB2 mRNA (Mann-Whitney). Black points represent individual biological replicates. Y axes are varied across similar plots to aid visualization.

Stimulation with exogenous TGFβ2 ligand further amplified the already heightened expression of COL1A1 and TGFB2 in SSc fibroblasts (Fig. 1, F and G). This result suggested that autocrine TGFβ2 signaling maintains profibrotic gene expression in SSc fibroblasts. To test this hypothesis, we used TGFB2-specific small interfering RNA (siRNA) to knock down expression of TGFβ2 (but not β1 or β3). We observed normalization of COL1A1 and SERPINH1 expression in patient fibroblasts (Fig. 1H), attesting to the pathogenic importance of TGFβ2.

Epigenetic modulation of a discrete TGFβ2 enhancer mitigates profibrotic gene expression in SSc fibroblasts

Given the absence of a strong genetic signature of SSc, we hypothesized that epigenetic events initiate and maintain a profibrotic state in SSc fibroblasts. To test this, we performed assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) to monitor chromatin accessibility in parallel with RNA-seq in control and patient fibroblasts from lesional skin (13). Although there was no global signature for enhanced chromatin accessibility at transcription start site regions in SSc fibroblasts compared to controls, the TGFβ signaling pathway was enriched among those genes that showed increased chromatin accessibility in SSc fibroblasts (fig. S6, A and B).

We hypothesized that SSc fibroblasts exhibited increased chromatin accessibility at the TGFB2 locus. We compared ATAC-seq signals in control and SSc fibroblasts with reference to the proximal promoter or enhancer sequences predicted by Encyclopedia of DNA Elements (ENCODE). We observed no differences in chromatin accessibility at the proximal promoter of TGFB2 between control and SSc fibroblasts (Fig. 2A). However, the TGFB2 locus contained numerous predicted enhancers.

Fig. 2 Epigenetic activation of the TGFB2 enhancer promotes profibrotic gene expression in SSc fibroblasts.

(A) ATAC-seq signals between healthy control and SSc fibroblasts at the TGFB2 locus were compared to ENCODE predictions for proximal promoter (orange) or putative enhancers (green), with the candidate enhancer of interest highlighted on the right. Genome-wide significant peaks at the TGFB2 enhancer are indicated by asterisks. (B) TGFB2 mRNA expression was regressed on estimated chromatin accessibility of the putative enhancer in control and patient fibroblasts. R2, coefficient for determination of linear regression. (C) Chromatin immunoprecipitation followed by qPCR (ChIP-qPCR) demonstrated H3K27ac or EP300 occupancy at the putative TGFB2 enhancer in fibroblasts. Values are represented as percent input normalized by immunoglobulin G control. (D) mRNA expression after targeted histone acetylation of the TGFB2 enhancer by coexpression of TGFB2 enhancer-specific guide RNA (sgRNA) and dCas9-EP300 (histone acetyltransferase and dCas9-EP300core) in control and SSc fibroblasts. dCas9-EP300Δ (dCas9-EP300D1399Y) contained a nonfunctional residue substitution at the acetyltransferase domain and was used as a negative control. (E) Targeting of dCas9-KRAB (histone methyltransferase) to the TGFB2 enhancer using TGFB2 enhancer-specific guide RNAs in control and SSc fibroblasts. *P < 0.05, **P < 0.01, and ***P < 0.001. ncontrol = 5 and nSSc = 6. Two-way Student’s t test or one-factor ANOVA with FDR correction were used for all experiments, except for (C) H3K27ac (Mann-Whitney), (D) TGFB1 mRNA (Kruskal-Wallis with FDR correction), and (E) COL1A1 and SERPINH1 mRNAs (Kruskal-Wallis with FDR correction). Black points represent individual biological replicates. Y axes are varied across similar plots to aid visualization.

To prioritize the predicted enhancers found near TGFB2, we compared ENCODE-predicted enhancer sequences in cell lines that did or did not express the cytokine. We identified a distal cluster of putative enhancers that showed a signature of open chromatin specifically among TGFB2-expressing cell lines (fig. S7). Within this cluster, patients with SSc exhibited higher chromatin accessibility at one of these putative enhancers (Fig. 2A). Three of three patients with SSc contained chromatin accessibility peaks at this putative enhancer with Bonferroni-corrected genome-wide significance (P = 1 × 10−30, P = 1 × 10−24, and P = 1 × 10−27), a signal only observed in one of three controls (P = 1 × 10−18). Furthermore, we found a correlation between the extent of chromatin accessibility at the enhancer with TGFB2 mRNA expression in both control and patient cells (R2 = 0.78, P = 0.03; Fig. 2B), a finding not observed for any of the other putative enhancers near the TGFB2 locus (fig. S8).

Consistent with our hypothesis, the putative enhancer in SSc fibroblasts exhibited epigenetic marks of enhancer activity, including elevated acetylation of H3K27 (H3K27ac) and occupancy by the histone acetyltransferase EP300 (Fig. 2C) (14, 15). These marks were not observed in patient fibroblasts derived from nonlesional skin (fig. S9). We observed no difference in trimethylation of H3K27, a repressive epigenetic mark, at this enhancer between control and lesional SSc fibroblasts (fig. S10). Together, these results suggest that the predicted enhancer has functional potential and remains operative in patient fibroblasts.

To assess the function of the putative enhancer, we targeted histone acetyltransferase activity using TGFB2 enhancer-specific guide RNAs with deactivated Cas9 tethered to the histone acetyltransferase domain of EP300 (dCas9-EP300core) (16). Targeted histone acetylation of the putative enhancer specifically induced TGFB2 (but not TGFB1 or TGFB3) expression in both control and patient fibroblasts (Fig. 2D). This occurred in association with elevated COL1A1 and SERPINH1 expression. These patterns were not observed when an inactive form of EP300 (dCas9-EP300D1399Y) was used as a negative control (Fig. 2D). These results indicated that histone acetylation of the putative enhancer was sufficient to induce TGFβ2 and TGFβ target gene expression. Furthermore, targeting of histone methyltransferase activity to the putative enhancer using deactivated Cas9 tethered to a Krueppel-associated box domain (dCas9-KRAB) was sufficient to normalize TGFB2 mRNA and profibrotic gene expression in patient fibroblasts (Fig. 2E) (17). These results suggest that epigenetic modifications that activate the TGFB2 enhancer contribute to the maintenance of a profibrotic state in SSc fibroblasts. In keeping with this hypothesis, Sanger sequencing did not reveal any patient-specific genetic variation in the TGFB2 enhancer sequence (data file S1).

TGFB2 enhancer activity rebounds after histone acetyltransferase inhibition

We next asked whether EP300 inhibition might decommission the TGFB2 enhancer. Treatment of lesional SSc fibroblasts with a small-molecule competitive inhibitor of EP300 (SGC-CBP30) decreased TGFB2 expression, EP300 occupancy, and H3K27ac at the TGFB2 enhancer (Fig. 3, A and B) (18). Unexpectedly, however, TGFB2 expression rebounded quickly upon removal of the drug, recapitulating steady-state amounts of TGFB2 expression, EP300 occupancy, and H3K27ac within 5 days after drug removal. These results suggested a mechanism of epigenetic memory that maintains heightened activity of the TGFB2 enhancer in SSc fibroblasts.

Fig. 3 BRD4 and NF-κB maintain epigenetic activation of the TGFB2 enhancer in SSc.

(A and B) TGFB2 expression and epigenetic modification of the TGFB2 enhancer were assayed immediately after treatment with EP300 inhibitor (SGC-CBP30) or after 5 days in fresh media sans SGC-CBP30. (C) ChIP-qPCR for BRD4 occupancy at the TGFB2 enhancer in baseline conditions (left) and in response to SGC-CBP30 treatment (right) in fibroblasts ex vivo. (D) ChIP-qPCR for acetylated p65 (activated NF-κB) occupancy at the TGFB2 enhancer in baseline conditions. (E) Chem-seq data revealed specific binding of JQ1, BRD4, and RNA polymerase II (RNApol II) at the TGFB2 enhancer highlighted on the right (21). (F) mRNA expression and epigenetic modifications of the TGFB2 enhancer upon siRNA knockdown of BRD4 mRNA in fibroblasts ex vivo. (G and H) Pulse-chase analysis of TGFB2 enhancer activity in response to JQ1 or BAY 11-7085 treatment up to 5 days after drug removal. (I) TGFβ2 protein expression in vehicle- or JQ1-treated fibroblasts. (J) TGFβ2 target gene expression in cultured control or SSc fibroblasts upon BRD4 inhibition by siRNA knockdown compared to scrambled siRNA control. (K) Collagen and TGFB2 expression upon cotreatment of JQ1 and TGFβ2 ligand in SSc fibroblasts. (L) Heat map of differentially expressed genes between vehicle- or JQ1-treated control and SSc fibroblasts by RNA-seq. n = 3, FDR < 0.05. JQ1-treated SSc fibroblasts clustered together with control fibroblasts in principal components analysis (PC1 and PC2 account for 65 and 14% of total variance, respectively). *P < 0.05, **P < 0.01, and ***P < 0.001. ncontrol = 5 and nSSc = 6, except for ChIP studies, where ncontrol = 4 and nssc = 4. Two-way Student’s t test for single comparisons or one-factor ANOVA with FDR correction were used for all experiments, except for (A) and (F) H3K27ac and BRD4 occupancy (Kruskal-Wallis with corrected FDR) and (D) (Mann-Whitney). Black points represent individual biological replicates.

BRD4 and NF-κB enforce epigenetic memory in SSc

BRD4 is a bromodomain and extraterminal domain (BET) family member that imposes epigenetic memory during mitosis and activates inflammation-associated enhancers through the proinflammatory transcription factor NF-κB (19, 20). In support of the hypothesis that NF-κB and BRD4 activate the TGFB2 enhancer in SSc fibroblasts, ChIP-qPCR revealed higher occupancy of BRD4 and activated NF-κB (acetylated p65; Fig. 3, C and D) at the TGFB2 enhancer in SSc fibroblasts derived from lesional skin but not in fibroblasts derived from nonlesional skin of patients compared to controls (fig. S9). We also observed increased NF-κB signaling in SSc fibroblasts, as assessed by coculturing of control or SSc fibroblasts with a cell line harboring a NF-κB reporter allele (fig. S11). In keeping with a contribution to epigenetic memory, BRD4 occupancy remained higher in lesional SSc fibroblasts than in controls throughout SGC-CBP30 treatment (Fig. 3C).

We independently validated these results using Chem-seq to identify genomic regions enriched upon pull-down of DNA-protein complexes that interact with the drug JQ1, a competitive inhibitor that blocks BRD4 and (with lower affinity) other BET family members from binding to acetylated lysine residues (21, 22). JQ1 was specifically bound to the TGFB2 enhancer under consideration in this study, with direct overlap of ChIP-seq signals for BRD4 and RNApol II observed (Fig. 3E).

We hypothesized that if NF-κB partners with BRD4 to activate the TGFB2 enhancer, then NF-κB signaling would induce TGFB2 expression. We also reasoned that inhibition of NF-κB or BRD4 would decommission the TGFB2 enhancer in SSc fibroblasts. Stimulation with tumor necrosis factor–α (TNFα, an activator of NF-κB) potently induced TGFB2 expression in control and SSc fibroblasts (fig. S12). Pretreatment with either an NF-κB inhibitor (BAY 11-7082) or JQ1 suppressed the effects of TNFα and abrogated TGFB2 expression. siRNA knockdown of BRD4 also suppressed TGFB2 mRNA expression in SSc fibroblasts, in addition to H3K27ac and BRD4 occupancy at the TGFB2 enhancer (Fig. 3F and fig. S13).

BRD4 and NF-κB inhibition results in durable TGFB2 enhancer decommission

We also found that JQ1 treatment was sufficient to suppress TGFB2 expression in SSc fibroblasts, an effect that was sustained after drug removal (Fig. 3G). These effects occurred in association with sustained normalization of H3K27ac and BRD4 occupancy at the TGFB2 enhancer. Similar findings were observed upon BAY 11-7082 treatment (Fig. 3H), suggesting that BRD4 and NF-κB stabilize epigenetic activation of the TGFB2 enhancer in SSc fibroblasts.

We next hypothesized that BRD4 inhibition with consequent suppression of TGFβ2 expression would normalize the fibrotic synthetic repertoire of lesional SSc fibroblasts. BRD4 inhibition abrogated TGFβ2 protein expression, in association with normalized type 1 collagen expression in SSc fibroblasts (Fig. 3, I and J). Treatment with TGFβ2 ligand in the presence of JQ1 potently induced collagen expression in SSc fibroblasts, supporting the concept that collagen suppression by JQ1 is secondary to TGFβ2 inhibition (Fig. 3K). TGFβ2 ligand stimulation in the presence of JQ1 (and hence BRD4 inhibition) failed to induce TGFB2 expression. Furthermore, RNA-seq and principal component analyses confirmed that JQ1 treatment mitigated gene expression differences between control and SSc lesional fibroblasts (Fig. 3L).

JQ1 treatment represses collagen synthesis and promotes collagen clearance in SSc skin explants

To test whether JQ1 treatment was sufficient to normalize profibrotic gene expression in a more physiologic context, control or SSc lesional skin biopsies were maintained in organ culture in the presence of vehicle or JQ1 for 10 days. JQ1 treatment normalized TGFB2 and COL1A1 expression in the dermis of SSc skin explants (Fig. 4). Picrosirius red and Masson’s trichrome staining revealed reduction of collagen in the superficial dermis of JQ1-treated patient skin (Fig. 5A and fig. S14). These results led us to hypothesize that BRD4 inhibition results in elevated collagenase expression in SSc skin. TGFβ signaling is known to suppress the expression of matrix metallopeptidase 1 (MMP1), the major type 1 collagenase in the skin (23, 24). We observed potent induction of MMP1 expression in JQ1-treated patient skin (Fig. 5B). In SSc fibroblasts, JQ1 treatment induced MMP1 expression, an effect abrogated by cotreatment with TGFβ2 ligand (fig. S15A). In keeping with these results, siRNA knockdown of TGFB2 increased MMP1 expression in SSc fibroblasts (fig. S15B). Together, these data suggest that the potential therapeutic efficacy of BRD4 inhibition in SSc encompasses both the suppression of profibrotic gene expression and the clearance of excessive extracellular matrix.

Fig. 4 Organ culture with JQ1 mitigates profibrotic gene expression in SSc skin.

mRNA in situ hybridization for TGFB2 (green foci) and COL1A1 (red foci) in the dermis of healthy control skin and SSc lesional skin biopsies maintained in organ culture with dimethyl sulfoxide (DMSO) or JQ1 for 10 days. Scale bars, 20 μm. Total number of fluorescent foci normalized to the number of nuclei was quantified and averaged from three different sections per biological replicate. ***P < 0.001. ncontrol = 4 and nssc = 4. One-factor ANOVA with FDR correction was used for all experiments. Black points represent individual biological replicates.

Fig. 5 Organ culture with JQ1 promotes collagen clearance in SSc skin.

(A) Picrosirius red staining in the dermis of healthy control skin and SSc lesional skin biopsies that were maintained in organ culture with DMSO or JQ1 for 10 days. Type 1 collagen (yellow/orange fibers) was visualized and quantified on the basis of light birefringence under polarized light. Dashed lines indicate the epidermal-dermal junction. Scale bars, 50 μm. (B) mRNA in situ hybridization for MMP1 (yellow foci) in the dermis of control and SSc skin biopsies maintained in organ culture with DMSO or JQ1 for 10 days. Scale bars, 20 μm. Total number of fluorescent foci was normalized by the total number of nuclei and averaged from two different sections per biological replicate. *P < 0.05, **P < 0.01, and ***P < 0.001. ncontrol = 4 and nssc = 4. One-factor ANOVA with FDR correction was used for all experiments except for (B) (Kruskall-Wallis with FDR correction). Black points represent individual biological replicates.

DISCUSSION

SSc is an etiologically mysterious disease in which previously healthy adults acquire an inflammatory prodrome that progresses to include a strong and unrelenting predisposition for fibrosis of the skin and viscera. Here, we show that constitutive epigenetic activation of a newly identified TGFB2 enhancer maintains a profibrotic state in lesional SSc fibroblasts in a mechanism dependent on BRD4 and NF-κB. We found that excessive TGFβ2 production by SSc fibroblasts resulted in heightened collagen deposition not only by inducing COL1A1 expression but also by stimulating the expression of SERPINH1 (a collagen-specific chaperone) and suppressing the expression of MMP1 (a dominant collagenase in human skin). TGFβ2 production by cells with a permissive epigenetic landscape could further amplify transcription at the TGFB2 locus, plausibly constituting a feed-forward mechanism relevant to the persistence of disease once established.

Analogous to the regulation of inflammatory enhancers initiated by inflammatory mediators like NF-κB and enforced by BRD4 (25, 26), we determined that NF-κB and BRD4 are necessary to maintain activity at the critical TGFB2 enhancer and the fibrotic synthetic repertoire in these patients with SSc. NF-κB is a signaling intermediate that is integrated into the inflammatory response to various environmental stimuli previously implicated in SSc, such as lipopolysaccharides, Toll-like receptor agonists, and TNFα (2729). This supports the hypothesis that the effects of various proposed triggers of inflammation in SSc (for example, microangiopathy, tissue injury, and infectious disease) converge, at least in part, through the activation of NF-κB (30, 31). Thus, this study both elucidates mechanism and suggests a potential vulnerability for fibrosis in SSc.

The question regarding how patients with SSc acquire epigenetic activation of the TGFB2 enhancer remains unanswered. Our data suggest a pathogenic sequence for some forms of SSc that initiates with an aberrant inflammatory response and is maintained through epigenetic memory at a specific enhancer for TGFB2. We hypothesize that environmental factors and the genetic proinflammatory susceptibility of patients with SSc combine to activate TGFB2 enhancer activity (11). It also remains unclear how various autoimmune disorders such as SSc, Grave’s disease, rheumatoid arthritis, systemic lupus, primary biliary cirrhosis, and psoriasis are predetermined in patients who share common susceptibility alleles. The possibility of disease-specific perturbations of epigenetic regulation deserves attention but remains speculative at this time.

Limitations of this study include the potentially limited pathophysiologic relevance of dermal fibroblasts studied ex vivo. Although we corroborated gene expression patterns observed in SSc fibroblasts in primary tissue, the cellular response to pharmacological inhibitors of BRD4, NF-κB, or P300 may differ in vivo, and we had limited ability to explore the chronicity of therapeutic effects in cell or organ culture systems. These experimental systems are also highly simplified and incapable of fully recapitulating paracrine effects, complex microenvironments, or the influence of immunologic mediators of disease. Last, we documented epigenetic dysregulation of TGFβ2 expression in cell lines or skin explants from a sample of patients with diffuse SSc. Additional work will be needed to determine whether this mechanism extends to other organ systems, other subgroups of patients with SSc, or different presentations of scleroderma.

In light of this study, treatment strategies for SSc that may warrant additional testing include selective TGFβ2, NF-κB, and/or BRD4 antagonists. We predict that TGFβ ligand targeting strategies that prioritize the potency of TGFβ2 neutralization will show the greatest efficacy. In addition, these data may help to predict the contexts within which inhibition of alpha(v) integrin-mediated activation of TGFβ holds potential for the treatment of fibrosis. Whereas both TGFβ1 and TGFβ3 can be activated by integrins, TGFβ2 is refractory because of lack of an RGD sequence in its latency-associated peptide (10). Last, these results reveal a basic biological mechanism for regulating TGFB2 enhancer activity and may inform pathogenic mechanisms for other TGFβ2-driven diseases, such as chronic obstructive pulmonary disease, glioblastoma, and glaucoma (3234).

MATERIALS AND METHODS

Study design

Our objective was to identify and target potential epigenetic mechanisms regulating profibrotic gene expression in primary dermal fibroblasts of patients with SSc. We hypothesized that SSc fibroblasts maintain transcriptomic differences (particularly of genes related to TGFβ and extracellular matrix synthesis) through an epigenetic mechanism. To test this, we studied skin explants or primary dermal fibroblast lines established from skin biopsies of healthy volunteers or patients with diffuse SSc in vitro. We further characterized SSc fibroblasts using dedicated functional studies (siRNA, dCas9-EP300core, and dCas9-KRAB) to support mechanistic conclusions. We tested potential therapeutic applications using fibroblasts or skin explants with the pharmacologic inhibitors of NF-κB, EP300, or BRD4. Power analysis was not used to calculate sample sizes. Once a protocol had been optimized, all experiments were included in the analysis if both control and experimental groups were performed in parallel and if internal controls were met. No outliers were excluded. All experiments were performed at least twice (fully independent experiments). Technical replicates for each patient were averaged, and each average served as a data point for comparison.

Participants

Healthy control donors and patients with diffuse SSc were recruited from the Johns Hopkins Scleroderma Center (table S1). Skin biopsies (4 mm) were taken from healthy control volunteers or from the lesional skin of patients with active diffuse SSc. Nonlesional skin biopsies were taken from four patients with diffuse SSc. Biopsies were taken from the forearm and cultured, as described previously (10). Autoantibody assays were performed as part of routine clinical care and/or using a commercially available immunoblot platform [Systemic Sclerosis (Nucleoli) profile, EUROIMMUN]. Patients were considered positive for a given autoantibody if they were positive by either method. All skin biopsies and research protocols were performed in compliance with the Johns Hopkins School of Medicine Institutional Review Board after informed consent.

Cell culture

Control and patient fibroblasts were maintained in complete media [Dulbecco’s modified Eagle’s medium (DMEM) + 10% fluorescence correlation spectroscopy (FCS) + Antibiotic-Antimycotic solution (Gibco) (Anti/Anti) + GlutaMAX].

SGC-CBP30, BAY 11-7082, and JQ1 pulse-chase analysis. Control and patient fibroblasts were treated with SGC-CBP30 (2.5 μM; Sigma-Aldrich), BAY 11-7082 (20 nM; Sigma-Aldrich), or JQ1 (0.25 μM; ApexBio) for 72 hours in complete media, followed by incubation in fresh complete media sans inhibitor for 5 days.

TNFα or TGFβ stimulation. Control and patient fibroblasts were preconditioned with BAY 11-7082 or JQ1 for 24 hours before TNFα or TGFβ stimulation (10 ng/ml, 12 hours; R&D Systems) in complete media.

RNA isolation, qPCR, and RNA-seq

RT-qPCR

Total RNA was isolated using TRizol (Invitrogen), according to manufacturer’s protocols. RNA was reverse transcribed to complementary DNA (cDNA) using a cDNA synthesis kit (Applied Biosystems). Relative transcript abundances for target genes were quantified using TaqMan probes (Applied Biosystems), as per the manufacturer’s protocol. Relative quantification of each target was normalized to GAPDH transcript abundance using the expression 2CT/2CT(GAPDH).

RNA-sequencing. To profile baseline transcriptomic differences, total RNA was isolated from three control fibroblast lines and three SSc fibroblast lines (derived from lesional skin) using TRizol and RNeasy isolation columns (Qiagen), as per the manufacturer’s protocol. DNA was digested with on-column deoxyribonuclease (DNase; Qiagen) treatment. The quality of the RNA used for sequencing was determined using an Agilent 2100 Bioanalyzer; all samples had RNA integrin numbers of at least 9.60. mRNA was enriched by poly-A selection, prepped using an Illumina TruSeq mRNA sample preparation kit, and sequenced by Illumina HiSeq 2000. Adapter sequences from 100–base pair (bp) paired-end FASTQ reads were trimmed using TrimGalore (https://github.com/FelixKrueger/TrimGalore). Trimmed sequence reads were aligned to hg19 using RSEM (35). Differential gene expression analysis was performed using DESeq2 package (36) with the gene count output from RSEM. The top differentially expressed genes [FDR < 0.05] were used to generate heat maps and for subsequent gene ontology analyses. To assess the therapeutic efficacy of JQ1, total RNA was isolated from three control fibroblast lines and three SSc fibroblast lines using TRizol after 48 hours of treatment with DMSO or JQ1. Samples were processed for RNA-seq as detailed above.

Western blotting

Cultured cells were washed with phosphate-buffered saline (PBS; Gibco), and lysate was collected in MPER (Thermo Fisher Scientific) with phosphatase inhibitor and protease inhibitor (Roche). Lysate concentration was quantified using a bovine serum albumin quantification kit (Thermo Fisher Scientific), and 8 μg of protein was loaded per sample onto 10% bis-tris gels (Criterion). Western blotting was performed using the Bio-Rad and LI-COR Odyssey detection systems. Antibodies used included TGFβ1, TGFβ2, TGFβ3, and β-actin (all from Abcam).

siRNA transfection

Cultured cells were transfected with siRNA against TGFB2 (Dharmacon) or BRD4 (Dharmacon) using DharmaFECT 1 transfection reagent, followed by mRNA isolation and RT-qPCR at 5 days after transfection.

Assay for transposase-accessible chromatin with high-throughput sequencing

Nuclei were isolated from three control and three SSc fibroblast lines using ATAC lysis buffer, transposed with Tn5 transposase (Illumina) for 30 min, and ligated with barcoded adapter sequences as previously described (13). Library quantitation and a quality check for proper nucleosomal laddering were performed using an Agilent 2100 Bioanalyzer before sequencing, as previously described (13), and 50-bp paired-end FASTQ reads were generated by Illumina HiSeq 2000. Adapter sequences were trimmed from high-quality FASTQ reads using TrimGalore (https://github.com/FelixKrueger/TrimGalore) and aligned to hg19 using Bowtie2 using the parameter –X2000, allowing fragments of up to 2 kb to be aligned (37). Duplicate sequence reads were identified and removed using Picard tools (http://picard.sourceforge.net) with default settings, as previously described (13). Remaining reads were filtered for alignment quality greater than Q30. Reads that mapped to mitochondria, unmapped contigs, or the Y chromosome were removed. Sequence reads were subsequently filtered for nucleosome-free reads based on read fragment size limits (0 to 100 bp) (13), followed by quantile normalization. We used MACS2 to call peaks with the parameters (--nomodel --nolambda --keep-dup all --call-summits) (38), a subset of which was removed using the consensus excludable ENCODE blacklist (http://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeMapability/). Peaks were mapped to nearest coding genes using BEDtools (39), and the height of each peak was used to identify genes with differential chromatin accessibility analysis between control and SSc fibroblasts using the EBSeq package (40).

Genome annotation

Proximal promoter and enhancer predictions. Browser extensible data tracks containing predictions for proximal promoters (DNase hypersensitive regions and H3K4me1+ regions) or distal regulatory elements (DNAse hypersensitive regions and H3K27ac+ regions) for 11 cell lines (astrocyte, endothelial cell, fibroblast, keratinocyte, epithelial cells, gastric cells, hepatic stellate cell, placental cells, GM12878, HepG2, and K562) were downloaded from ENCODE (http://promoter.bx.psu.edu/ENCODE/download.html). Transcript per million (TPM) values for these 11 cell lines were also queried using the ENCODE database (http://promoter.bx.psu.edu/ENCODE/search_human.php) and used to group cell lines as expressors (TGFB2 TPM equal to or greater than 1) or nonexpressors of TGFB2 (TGFB2 TPM less than 1).

Chem-seq. Chem-seq tracks for JQ1 and ChIP-seq tracks for BRD4 and RNApol II were downloaded from Gene Expression Omnibus (GEO) accession nos. GSE44098 and GSE43743, respectively (21), and aligned using Integrative Genomics Viewer (41) to qualitatively identify genomic regions that exhibited signals for JQ1, BRD4, and RNApol II occupancies.

Transfection with dCas9-EP300 and dCas9-KRAB constructs

Cultured cells were transfected with expression constructs encoding dCas9-EP300core, dCas9-EP300D1399Y, or dCas9-KRAB (gifts from C. Gersbach’s laboratory, Addgene) with or without sgRNA specifically designed to target the TGFB2 enhancer (designed using CRISPR design, Addgene). Constructs were transfected using Lipofectamine (Invitrogen) in OptiMEM (Gibco), as per the manufacturer’s protocols. Total RNA was isolated from EP300- and KRAB-transfected cells 3 and 5 days after transfection, respectively.

Chromatin immunoprecipitation

Cultured cells were washed with PBS and cross-linked with 1% formaldehyde, followed by cell lysis using SDS buffer. Lysate was sonicated with Bioruptor UCD-200 (Diagenode), followed by incubation with Dynabeads (Invitrogen) conjugated with rabbit-derived antibodies: BRD4 (Bethyl Laboratories), EP300 (Bethyl Laboratories), acetylated p65 (NF-κB), H3K27ac (Abcam) H3K27me3 (Millipore), or isotype control (Abcam). Protein/DNA/bead complexes were washed with radioimmunoprecipitation assay buffer (RIPA buffer; RIPA + NaCl, LiCl, and TE buffer. Protein/DNA complexes were eluted with elution buffer. Reverse cross-linking was performed overnight at 65°C, followed by DNA purification and qPCR. ChIP signal was normalized to total chromatin input (percent input), which was calculated as 100 × 2(CTinput-CTtarget). Primers used for TGFB2 enhancer ChIP were AGCCAGTTGAGGAGTTTCACA (forward) and AAGCATTTGGTAGTGAGTCATCC (reverse).

Organ culture

Biopsies (4 mm) taken from healthy controls or the lesional skin of patients with diffuse SSc were cut into two 2-mm pieces. One piece was cultured in DMEM + 10% FCS + Anti/Anti with DMSO, whereas the other was cultured in DMEM + 10% FCS + Anti/Anti with JQ1 (2.5 μM). After 10 days of treatment, samples were formalin-fixed and paraffin-embedded (FFPE) for histological assessment and in situ hybridization.

mRNA in situ hybridization

FFPE sections of control and SSc skin were deparaffinized and prepared for in situ hybridization, as per the manufacturer’s protocol (Advanced Cell Diagnostics). Probes used included TGFB2-C1, COL1A1-C2, and MMP1-C1 (Advanced Cell Diagnostics). Fluorescent images were taken by confocal microscopy. Total numbers of fluorescent foci were quantified by the Spots function of Imaris microscopy imaging software.

NF-κB luciferase reporter cell line coculture

Control or SSc dermal fibroblast lines were cocultured with NF-κB luciferase reporter National Institutes of Health (NIH) 3T3 stable cell lines (Signosis) in DMEM + 10% FCS for 3 days. Cells were trypsinized, lysed, and given firefly substrate (Signosis). Luciferase activity was quantified using BioTek luminometer.

Sanger sequencing

Genomic DNA from three healthy control or three SSc fibroblast lines was isolated using the DNeasy Blood and Tissue Kit (Qiagen), and PCR was performed using three primer pairs, which amplified three overlapping amplicons spanning the TGFB2 enhancer. The PCR products were purified using a Gel Extraction kit (Qiagen) and sequenced using the same primer pairs and a BigDye Terminator kit v3.1 (Applied Biosystems). Linear amplification products were separated in an automated capillary sequencer (Applied Biosystems). Three overlapping amplicons were stitched together using Sequencher software version 4.8 to form a continuous DNA sequence for the TGFB2 enhancer. Primer sequences were as follows: enhancer part 1, TACAAAAGCAGGCAATGAGC (forward) and CGTCAGAAACCTGGACAACA (reverse); enhancer part 2, TTGCTAGCATTGTGTCAGCAC (forward) and GAGGGGGATATAATGGGAACA (reverse); enhancer part 3, AGACCCGGTAAAAGCCAGTT (forward) and GCCAGGCACAACACAGAATA (reverse).

Statistical methods

Data are shown as standard box-and-whisker plots with individual data points produced using Prism (GraphPad) software and R. Lower and upper margins of each bar (blue bar, control; red bar, SSc) indicate 25th and 75th percentiles, respectively; the internal line indicates the mean, and whiskers indicate the range. Black points represent individual biological replicates. Heat maps were generated using R, HOMER, and Java TreeView. All independent technical replicates for each patient were averaged into a single data point. A two-tailed t test was used for single comparisons between two groups, and one-factor ANOVA with Benjamini, Krieger, and Yekutieli’s two-stage method for controlling for multiple hypotheses was used for multiple comparisons of normally distributed datasets (confirmed by Shapiro-Wilk normality test; data file S2). For nonnormal data, Mann-Whitney tests were used for single comparisons between two groups, and the Kruskal-Wallis test followed by Benjamini, Krieger, and Yekutieli’s two-stage method for controlling for multiple hypotheses was used for multiple comparisons. P values for ATAC-seq peaks generated by MACS2 statistical package were Bonferroni-corrected for genome-wide significance (P < 6.6 × 10−9). Statistical analyses were calculated using Prism software, DESeq2, EBSeq, MACS2, and R. P < 0.05 and FDR < 0.05 were used as thresholds for statistical significance. All experiments, except for RNA-seq and ATAC-seq, were repeated at least twice.

SUPPLEMENTARY MATERIALS

stm.sciencemag.org/cgi/content/full/11/497/eaaw0790/DC1

Fig. S1. SSc fibroblasts maintain profibrotic gene expression pathways.

Fig. S2. SSc fibroblasts actively transcribe TGFB2 mRNA.

Fig. S3. Nonlesional SSc fibroblasts exhibit profibrotic gene expression.

Fig. S4. Quantification of TGFB2 mRNA by in situ hybridization.

Fig. S5. mRNA in situ hybridization for TGFB isoform expression in SSc lesional skin.

Fig. S6. SSc fibroblasts exhibit increased chromatin accessibility in genes related to profibrotic pathways.

Fig. S7. TGFβ2-expressing cell lines contain unique predicted enhancers at the TGFB2 locus.

Fig. S8. TGFβ2 enhancer accessibility correlates with TGFB2 mRNA expression.

Fig. S9. TGFB2 enhancer is inactive in nonlesional SSc fibroblasts.

Fig. S10. The TGFB2 enhancer exhibits minimal H3K27me3 modification in lesional SSc fibroblasts.

Fig. S11. SSc fibroblasts exhibit high NF-κB signaling activity.

Fig. S12. TNFα induces TGFB2 enhancer activity in a NF-κB– and BRD4-dependent manner.

Fig. S13. siRNA knockdown of BRD4 abrogates BRD4 mRNA expression.

Fig. S14. JQ1 treatment reduces collagen content in SSc skin explants.

Fig. S15. TGFβ2 inhibition by JQ1 or siRNA induces MMP1 expression in SSc fibroblasts.

Table S1. Patient data on SSc skin biopsy donors and healthy volunteers.

Data file S1. Sanger sequencing results.

Data file S2. Shapiro-Wilk test results for normally distributed datasets.

REFERENCES AND NOTES

Acknowledgments: We thank A. Rosen, H. Bjornsson, and J. C. Shin for consultation on experimental design and S. Cooke and R. Bagirzadeh for technical support. Funding: These studies were funded by the Scleroderma Research Foundation (to H.C.D.), the Howard Hughes Medical Institute (to H.C.D.), NIH R01 [to H.C.D. and D.W. (R01AR068379)], Staurulakis Family Discovery Fund (to A.A.S.), NIH U01 [to M.A.B. (U01HG009380)], and NIH R01 [to M.A.B. (R01HG007348)]. The Experimental and Computational Genomics Core at the Johns Hopkins Sidney Kimmel Comprehensive Cancer Center was supported by NIH P30 CA006973. Author contributions: J.Y.S. and H.C.D. conceived the project and wrote the manuscript. J.Y.S. was involved in planning and performing all experiments. A.A.S., Z.M., J.J.P., M.M.S., and F.M.W. were involved in capturing biopsies. J.D.B., R.B., T.J.C., E.G.M., and D.W. were critical in designing experiments. M.A.B. assisted with bioinformatic analyses. Competing interests: H.C.D is a consultant for GlaxoSmithKline and founder and consultant for Blade Therapeutics. A provisional patent titled “Targeted epigenetic therapy against distal regulatory element of TGFB2 expression” has been filed (U.S. provisional patent application no. 62/624,024). All other authors declare that they have no competing interests. Data and materials availability: All data associated with this study are present in the paper or the Supplementary Materials. The plasmids used for dCas9-mediated epigenome targeting were provided through a material transfer agreement with Addgene. The high-throughput sequencing datasets (RNA-seq and ATAC-seq) generated during the current study have been deposited to the GEO repository (GSE130313).
View Abstract

Stay Connected to Science Translational Medicine

Navigate This Article