Research ArticleINFERTILITY

A pannexin 1 channelopathy causes human oocyte death

See allHide authors and affiliations

Science Translational Medicine  27 Mar 2019:
Vol. 11, Issue 485, eaav8731
DOI: 10.1126/scitranslmed.aav8731

A vital gene for oocytes

Infertility is common in both males and females, but the biological causes of female infertility are not as well understood. Sang et al. identified four families with inherited female infertility and a similar phenotype that presents with oocyte death in vitro, either before or shortly after fertilization. The authors found that this phenotype was caused by mutations in pannexin 1, a channel protein involved in cellular communication. The authors examined the mechanism of pathogenesis associated with these mutations and showed that a patient-derived mutation causes the same pattern of oocyte death in a mouse model, providing a possible target for therapeutic development.

Abstract

Connexins and pannexins are two protein families that play an important role in cellular communication. Pannexin 1 (PANX1), one of the members of pannexin family, is a channel protein. It is glycosylated and forms three species, GLY0, GLY1, and GLY2. Here, we describe four independent families in which mutations in PANX1 cause familial or sporadic female infertility via a phenotype that we term “oocyte death.” The mutations, which are associated with oocyte death, alter the PANX1 glycosylation pattern, influence the subcellular localization of PANX1 in cultured cells, and result in aberrant PANX1 channel activity, ATP release in oocytes, and mutant PANX1 GLY1. Overexpression of a patient-derived mutation in mice causes infertility, recapitulating the human oocyte death phenotype. Our findings demonstrate the critical role of PANX1 in human oocyte development, provide a genetic explanation for a subtype of infertility, and suggest a potential target for therapeutic intervention for this disease.

INTRODUCTION

Successful human reproduction requires normal spermatogenesis, oogenesis, fertilization, and embryonic development (13). Human infertility due to abnormal spermatogenesis has been widely reported, and the underlying genetic basis has been extensively studied (4, 5). However, the genetic basis of defects in the process of oocyte development, fertilization, and subsequent early embryonic development has been relatively poorly investigated. With the development of in vitro fertilization (IVF) techniques and the burgeoning increase in application of IVF worldwide (6), the processes of oocyte development, fertilization, and early embryonic development can now be accurately evaluated and investigated, facilitating the discovery of phenotypes and genes responsible for female infertility.

Cellular communication is a crucial aspect of development and is important in maintaining normal physiological states within organisms. Such communication involves the connexin and pannexin families of large-pore channels (7). Pannexin 1, encoded by PANX1, is the most extensively studied of the three members of the pannexin family of glycoproteins (8). Found more than a decade ago, PANX1 has been implicated in several physiological and pathophysiological functions, including cell clearance (9, 10), inflammation (11), viral infection (12), cancer progression (13), ischemia (14), and neurological disorders (1517). The pannexin 1 channel is a major adenosine 5′-triphosphate (ATP) release and nucleotide permeation channel (18). It can be activated or inhibited by changes in extracellular K+, intracellular Ca2+, ATP, voltage changes, or mechanical stimulation (19, 20). However, two lines of evidence seem to question its biological importance. First, Panx1 knockout mice are viable and fertile (2124), show no signs of major organ defects, and only show some defects with certain challenging factors, including age (21), drugs (23), stress (24), etc. Second, there are no studies demonstrating a causal relationship between mutations in PANX1 and any human disease.

Here, we describe a form of familial or sporadic female infertility with a Mendelian phenotype that we refer to as “oocyte death.” We identify mutations in PANX1 responsible for this phenotype and describe the effects of the mutations in cultured cells, in Xenopus laevis oocytes, in mouse oocytes, and in the case of one of the patient-derived mutations, via overexpression in engineered mice.

RESULTS

Clinical characterization

Initially, we identified a four-generation family (family 1) with a possible autosomal dominant inheritance pattern of primary infertility (Fig. 1). In this family, three sisters (III-1, III-2, and III-3) were diagnosed with primary infertility of unknown cause. All had regular menstrual cycles and normal sex hormone concentrations. For patient III-1, as noted in her medical records, 22 oocytes were retrieved during her IVF treatment cycles, but in each case, all oocytes died at an unknown stage the following day. For patient III-2, eight oocytes [including five immature oocytes and three metaphase II (MII) oocytes] were retrieved, of which seven gradually degenerated and died within 20 hours, accompanied by cytoplasmic shrinkage and darkening before fertilization. Only one MII oocyte formed pronuclei after intracytoplasmic sperm injection (ICSI), but it also died within 20 hours. For patient III-3, three IVF/ICSI cycles were performed. A total of 48 oocytes were retrieved, of which 46 either degenerated shortly after retrieval or died within 20 hours. Only two MII oocytes fertilized normally with visible pronuclei, but these also died within 20 hours (Table 1 and Fig. 2). In another independently recruited case (II-1 in family 2) with a similar phenotype (Table 1 and Fig. 2), 33 oocytes were retrieved in two IVF/ICSI cycles, of which 29 oocytes were dead upon retrieval and the remaining 4 oocytes also died within 20 hours (Table 1 and Fig. 2). We refer to this phenotype as oocyte death. A third five-generation family (family 3) had a similar but slightly different phenotype, such that oocyte death occurred only after fertilization (Fig. 1). The 35-year-old proband (III-3) and her two female cousins (III-1 and III-2) suffered from primary infertility of unknown cause for several years, although all had regular menstrual cycles and normal sex hormone concentrations. From three recurrent failed IVF/ICSI attempts of the proband, a total of 37 oocytes were retrieved, including 11 immature oocytes and 26 morphologically normal MII oocytes, of which 25 were successfully fertilized with two pronuclei (2 PN). However, all fertilized oocytes died within 30 hours in the same manner as seen in patients in families 1 and 2 (Table 1 and Fig. 2).

Fig. 1 Pedigrees and PANX1 status of individuals affected by oocyte death.

Each affected individual carries a heterozygous mutation; Sanger sequencing confirmation is shown below the pedigrees. Mutations Q392* (family 1), K346E (family 2), and C347S (family 3) in PANX1 were inherited from the fathers of the affected individuals. Parent information for the patient in family 4 was not available (indicated by question marks). “W” indicates WT allele, an “equal” symbol indicates infertility, and black circles indicate affected individuals.

Table 1 Clinical characteristics of patients and their retrieved oocytes.

View this table:
Fig. 2 Morphology of oocytes retrieved from control individuals and patients.

(A) Control oocytes at different stages. Twenty hours after ICSI indicate 2 PN stage; 30 hours after ICSI indicate stage of pronuclear disappearance. GV, germinal vesicle. (B) Morphology of retrieved oocytes from patients in family 1. 0 hours, time of oocyte retrieval; 20 hours, period of oocyte cultivation without ICSI. (C) Morphology of oocytes from patient II-1 in family 2. Most oocytes were dead upon retrieval (0 hours). (D) Morphology of oocytes from patient III-3 in family 3. All fertilized oocytes had died within 30 hours. Black arrows indicate pronuclei. Scale bars, 40 μm.

We performed a retrospective analysis of patient databases in collaborating hospitals and identified a further case (family 4) that presented with the same phenotype noted in patients in family 3 (Fig. 1). The patient was diagnosed with primary infertility of unknown cause and had three failed IVF/ICSI attempts 15 years ago. During her IVF/ICSI attempts, 41 morphologically normal MII oocytes were retrieved and 30 of them were successfully fertilized with 2 PN. However, all fertilized oocytes died without cleavage over the course of the following day (Table 1).

Identification of PANX1 mutations

Whole-exome sequencing was performed in six individuals in family 1 (patients III-1, III-2, and III-3, fertile individual III-4, and their parents II-1 and II-2) and in three individuals from family 3 (proband III-3, her mother II-2, and patient III-1). After data filtering based on a public exome database, our in-house exome database, and oocyte gene expression databases, a heterozygous nonsense mutation c.1174C > T (p.Q392*) in PANX1 was the only mutation that cosegregated with all three infertile patients in family 1. For family 3, a heterozygous missense mutation c.1040G > C (p.C347S) in PANX1 was the only mutation that cosegregated with infertility (Fig. 1). Both mutations in families 1 and 3 were inherited from the patient’s father. The two mutations were further verified by Sanger sequencing (Fig. 1).

Sanger sequencing of PANX1 exons identified a heterozygous missense mutation c.1036A > G (p.K346E) in family 2 and a nonframeshift deletion mutation c.61_69delACGGAGCCC (p.21_23delTEP) in family 4 (Fig. 1), further highlighting the genetic contribution of PANX1 to this phenotype. None of the four mutations were present in the Genome Aggregation Database. Overall, four distinct types of PANX1 mutation were identified in four independent families, with the oocyte death phenotype either before or after fertilization. The positions of the mutations and an evolutionary conservation analysis are shown in Fig. 3 (A and B).

Fig. 3 Mutation distribution, sequence alignment, spatiotemporal expression of PANX1, and effects of PANX1 mutations on glycosylation and membrane targeting.

(A) Distribution of four disease-causing mutations in PANX1. All mutations were located in the cytoplasmic region and are highlighted in red. OM, outer cell membrane; IM, inner cell membrane. (B) Sequence alignment showing evolutionary conservation of amino acid residues K346 and C347. (C) qRT-PCR analyses showing relative PANX1 expression at different stages of human oogenesis, early embryos, sperm, and a range of somatic tissues. Data are shown as the means ± SEM. For each kind of tissue, n = 3 biological replicates. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. (D) Immunofluorescence of control oocytes and human embryos at different stages. Oocytes and embryos were probed with an antibody against PANX1 (green) and 4′,6-diamidino-2-phenylindole (DAPI; blue) for DNA visualization. PANX1 primary antibody preadsorbed by relevant recombinant immunogenic protein was used as a negative control (NC). Spindles of MI and MII oocytes were stained with an anti–α-tubulin antibody (red). White arrows indicate spindles; white arrowhead highlights pronuclei. Scale bar, 80 μm. (E) Western blot analysis of HeLa cell extracts after transfection with WT or mutant PANX1 expression constructs. The positions of full-length bands are shown at right. Note that the band position of mutant Q392* (indicated by arrow) is lower than the control because of the nonsense mutation. Vinculin was used as a loading control (bottom). (F) Cell surface biotinylation of HeLa cells expressing WT and mutant PANX1. Biotinylated (bound) and nonbiotinylated (unbound) proteins were probed with an antibody to PANX1. Antibodies to vinculin and Na+- and K+-dependent adenosine triphosphatase (ATPase) were used as cytoplasmic and membrane loading controls, respectively (bottom). Each experiment was repeated three times.

Expression and subcellular localization of PANX1

Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis showed that PANX1 expression is highest in human oocytes, eight-cell embryos, and the brain (compared to other somatic tissues) (Fig. 3C). To explore the subcellular localization of PANX1, we examined human GV, MI and MII oocytes, zygotes, and early embryos by immunofluorescence. PANX1 was mainly localized either on the cell membrane of human oocytes and zygotes or at cell-cell interfaces in early embryos (Fig. 3D). These results imply that PANX1 might have important (patho)physiological functions in the oocyte cell membrane and in early embryos.

Effects of mutations on PANX1 glycosylation and subcellular localization in cultured cells

PANX1 exists in three glycosylation states—the nonglycosylated protein (GLY0), a high-mannose glycoprotein (GLY1), and a fully mature glycoprotein (GLY2) (25). To investigate the effects of the mutations we identified on PANX1 glycosylation in vitro, we examined HeLa cells 36 hours after transfection with wild-type (WT) or mutant constructs. To confirm that the effect was caused specifically by the mutations in PANX1, two other variants (p.R217H and p.I272V) were included. Homozygous p.R217H was recently identified in a single patient diagnosed with multisystem dysfunction including intellectual disability, sensorineural hearing loss, kyphosis, and primary ovarian failure, but a causal relationship between p.R217H and the multisystem dysfunction could not be established (26). p.I272V was randomly chosen from common variants of PANX1 with minor allelic frequencies of 10% in the general population. Compared with WT PANX1 and the two variant forms of PANX1, all mutants resulted in a complete absence of the GLY2 species, whereas the GLY1 form was retained but in reduced amounts (Fig. 3E). Both GLY2 and GLY1 bands are sensitive to cleavage by N-glycosidase F (PNGase F), whereas only GLY1 is sensitive to endoglycosidase H (Endo H) (27). We therefore confirmed the band shifts we observed by treatment with PNGase F and Endo H (fig. S1, A and B). In addition, we found that calreticulin (a chaperone that promotes glycoprotein folding) was up-regulated in HeLa cells expressing mutant PANX1 (fig. S1C), suggesting that the proper folding of mutant PANX1 may be compromised (28, 29).

The GLY1 pattern is formed in the endoplasmic reticulum; the protein is then transported to the Golgi body where it matures into the fully glycosylated GLY2 form, which is then targeted to the cell membrane (27). In our immunofluorescence experiments, WT PANX1 and two variant forms of PANX1 (R217H and I272V) were mainly located at the cell membrane [the data for R217H are consistent with a previous study (26)], whereas in the case of all four patient mutations, most of the PANX1 mutants localized in the cytoplasm; all four mutants also appeared in cytoplasmic aggregates (fig. S1, C and D). To further determine the subcellular localization of these aggregates, we used GM130, a Golgi marker. As shown in fig. S1D, all four PANX1 mutants showed evidence of colocalization with the Golgi body, suggesting the latter as a site of mutant protein retention.

Because PANX1 forms membrane channels (30), we next investigated the ability of mutant PANX1 to be targeted to the cell membrane. As shown in Fig. 3F, both WT and mutant PANX1 could be isolated from the cell membrane. The predominant glycosylation species on the cell membrane was GLY2 for WT PANX1 but GLY1 in the case of all four PANX1 patient mutations, indicating that, although there is retention of mutant PANX1 in the Golgi body (fig. S1D), the mutant form of PANX1 GLY1 can still traffic to the cell membrane. Together, these data suggest that disease-causing mutations in PANX1 result in an altered glycosylation pattern upon expression in HeLa cells.

Mimicking the oocyte death phenotype in mouse oocytes

To establish a causal relationship between PANX1 mutations and the oocyte death phenotype, WT and mutant PANX1 complementary RNAs (cRNAs) [RNA transcripted from complementary DNA (cDNA)] were microinjected into mouse GV oocytes at three different concentrations (50, 100, and 200 ng/μl). GV oocytes were allowed to mature in vitro for 12 hours and were then used for IVF. Similar to the phenotype observed in patients from families 1 and 2, mouse oocytes injected with mutant p.Q392* or p.K346E cRNA gradually degenerated, with cytoplasmic shrinkage at 12 hours and death when cultured for up to 20 hours (Fig. 4, A and B). The phenotype had a dosage-dependent effect (Fig. 4, C and D). In comparison, after 12 hours cultivation, oocytes injected with mutant p.C347S or p.21_23delTEP cRNAs matured normally and contained a first polar body (Fig. 4A). However, these oocytes gradually died within 10 hours after IVF, again with an injection dosage effect (Fig. 4, E and F); more than 60% of oocytes died within 10 hours after IVF at a concentration of 200 ng/μl, mimicking the phenotype of patients from families 3 and 4. To confirm the phenotypic specificity of the four patient-derived mutations, p.R217H or p.I272V cRNAs were injected into oocytes that were then used for IVF. None of these oocytes died either before or after fertilization (fig. S2A). To confirm the severe effects of mutations p.C347S or p.21_23delTEP in oocytes after fertilization, normal 2 PN zygotes were injected with corresponding mutant cRNAs at a concentration of 50 ng/μl. All 2 PN zygotes died within 12 hours (fig. S2B), exhibiting more severe phenotypes than in the case of injection into GV oocytes. These results corroborate our finding that oocytes are more vulnerable to mutant PANX1 after fertilization. Together, these data demonstrate that disease-causing mutations in PANX1 cause the oocyte death phenotype.

Fig. 4 Mimicking the oocyte death phenotype in mouse oocytes in vitro.

(A) Images of mouse GV oocytes injected with WT or mutant cRNAs at 12 hours. (B) Images of mouse GV oocytes injected with Q392* or K346E cRNA and cultured for up to 20 hours. (C) Statistical analysis of degenerated oocytes corresponding to images in (A). Data are shown as the means ± SEM; n = 3 biological replicates. (D) Statistical analysis of dead oocytes corresponding to images in (B). Mouse oocytes injected with Q392* or K346E cRNA were cultured for up to 20 hours, and the percentage of dead oocytes was determined. Data are shown as the means ± SEM; n = 3 biological replicates. (E) Images of mouse MII oocytes after fertilization. GV oocytes injected with C347S or 21_23delTEP cRNAs were allowed to mature in vitro for 10 hours and used for IVF. The total number of oocytes used is listed above each bar. Arrows indicate degenerated or dead oocytes. Scale bars, 80 μm. (F) Statistical analysis of dead oocytes corresponding to images in (E). The percentage of oocytes that died after fertilization was determined. Data are shown as the means ± SEM; n = 3 biological replicates. Numbers of oocytes used in (C), (D), and (F) are shown in table S2.

Association between mutant forms of GLY1 and oocyte death

As shown in Fig. 3E, all four mutations resulted in an altered PANX1 glycosylation pattern characterized by a lack of GLY2, whereas GLY1 was retained. We therefore investigated whether an altered glycosylation pattern is associated with the oocyte death phenotype. We first predicted potential N-glycosylation sites in human PANX1 using the NetNGlyc prediction tool and identified three glycosylation sites: N255, N338, and N394. N255Q, N338Q, and N394Q mutations were then introduced into expression vectors and used for transfection into HeLa cells. Western blotting showed that only N338Q resulted in an altered glycosylation pattern similar to that induced by patient mutations. Mutant N255Q resulted in the loss of both GLY2 and GLY1, whereas N394Q had no impact on the PANX1 glycosylation pattern (fig. S3A). We also microinjected WT, N255Q, N338Q, and N394Q PANX1 cRNAs into mouse GV oocytes. As shown in fig. S3B, only the N338Q mutant exhibited the oocyte death phenotype, whereas mutants N255Q and N394Q had no discernable effect on oocyte survival. We conclude that the oocyte death phenotype is associated with an altered glycosylation pattern resulting from certain mutations, although there is no evidence that mutant forms of GLY1 are the direct cause of the phenotype.

To further confirm the association between altered glycosylation and the phenotype, we injected WT and each of four mutant cRNAs into mouse GV oocytes and monitored the resulting glycosylation patterns. Compared with HeLa cells, the glycosylation pattern of PANX1 in mouse oocytes was distinct (fig. S3C): Only GLY1 was observed in oocytes injected with either WT or any of the mutant cRNAs. As shown in Fig. 4 (A to F), oocytes injected with WT were normal, whereas oocytes injected with mutant RNAs died either before or after fertilization. It therefore seems likely that a defective form of GLY1 produced by mutation in PANX1 is associated with oocyte death. To further analyze the relationship between abnormal GLY1 and the oocyte death phenotype, the N255Q mutation, which results in a complete absence of both GLY1 and GLY2, was introduced into the p.C347S, p.Q392*, p.K346E, and p.21_23delTEP constructs. No mutant GLY1 or GLY2 was produced in the case of double-mutant constructs expressed in HeLa cells (fig. S3D). We injected corresponding double-mutant cRNAs into mouse oocytes and, as expected, found no evidence of oocyte death either before or after fertilization (fig. S3E). We conclude that the mutant form of GLY1 is associated with the oocyte death phenotype.

Channel activation, altered membrane properties, and aberrant ATP release caused by PANX1 mutations

To determine whether the mutations we identified cause the oocyte death phenotype by altering channel activity, we used a channel inhibitor [carbenoxolone (CBX)] in a rescue experiment. Mutant cRNAs were injected into mouse GV oocytes (for mutants p.Q392* and p.K346E) or into 2 PN zygotes (for mutants p.C347S and p.21_23delTEP), which were then cultured in the presence or absence of CBX. In the groups free of CBX, most of the oocytes or zygotes degenerated or died within 6 hours, whereas oocytes or zygotes incubated with CBX were all viable at 6 hours (Fig. 5, A and B). These data suggest that the patient-derived mutations result in enhanced channel activation. We therefore analyzed the effect of mutant PANX1 on the biophysical properties of channel activity via electrophysiological recordings in X. laevis oocytes. Compared to the WT group, all four mutant groups showed an increase in channel activity, with reduced resting membrane potentials and much higher maximum current (Fig. 5, C to E). Application of CBX decreased the current amplitudes in the injected group (fig. S4). In addition, because PANX1-mediated ATP release is a key consequence of PANX1 activation (31), we measured the extracellular and intracellular ATP content in oocytes or 2 PN zygotes injected with WT or mutant cRNAs. As shown in Fig. 5 (F and G), the extracellular ATP content was significantly increased in groups injected with mutant cRNAs (P < 0.001), whereas the intracellular ATP content was decreased (fig. S5, A and B). These changes were reversed by adding CBX, confirming that channel activation is caused by the mutations. We conclude that the mutations activate the channel and result in aberrant ATP release and that this effect is likely to contribute, at least in part, to oocyte death.

Fig. 5 Phenotypic rescue, ATP measurements, and membrane electrophysiology.

(A) GV oocytes were injected with WT, Q392*, or K346E cRNAs and cultured in M2 medium either with (+) or without (−) CBX for 6 hours (n = 3 biological replicates). Scale bar, 80 μm. (B) 2 PN zygotes collected at 6 hours after IVF were injected with WT or C347S or 21_23delTEP cRNAs and cultured in KSOM either with (+) or without (−) CBX for 6 hours (n = 3 biological replicates). Scale bar, 80 μm. (C) Average I to V (current voltage) curves from X. laevis oocytes expressing WT or mutant PANX1. Data are shown as the means ± SD of four to eight oocytes. (D) Resting membrane potentials in X. laevis oocytes after expression of PANX1 mutants. Data are shown as the means ± SD of three to eight oocytes. **P < 0.01, *P < 0.05. (E) Maximum currents in X. laevis oocytes after expression of PANX1 mutants. Data are shown as the means ± SD of four to eight oocytes. One-way analysis of variance (ANOVA), followed by Tukey test. ***P < 0.001. (F) Relative ATP content of the extracellular medium collected in (A). Data are shown as the means ± SEM. One-way ANOVA, followed by Tukey test (n = 4 biological replicates). ***P < 0.001. (G) Relative ATP content of the extracellular medium collected in (B). ATP content was measured at 4 hours before the death of the zygotes. Data are shown as the means ± SEM. One-way ANOVA, followed by Tukey test (n = 3 biological replicates). ***P < 0.001.

Recapitulating infertility and the oocyte death phenotype in PANX1 Q392* overexpression in mice

To evaluate the effect of PANX1 mutations on female fertility in vivo, we generated Panx1Q392*, Panx1C346S, Panx1K345E, and Panx121_23delTEP knock-in (KI) mice (fig. S6A). Unexpectedly, all heterozygous Panx1Q392*, Panx1C346S, Panx1K345E, and Panx121_23delTEP KI female mice were healthy and fertile (fig. S6B). Homozygous Panx1Q392* and Panx121_23delTEP KI mice were also fertile (fig. S6B), whereas homozygous Panx1C346S and Panx1K345E KI mice were unavailable because of perinatal lethality. Given that the oocyte death phenotype can be precisely mimicked in mutant PANX1 cRNA–injected mouse oocytes and that such experiments show an obvious dosage dependence, we hypothesized that comparatively low PANX1 protein expression in mouse oocytes might explain the failure to recapitulate the oocyte death phenotype. To address this issue, we compared the expression of PANX1 in human and mouse oocytes and found that PANX1 is substantially higher in human oocytes compared to mouse oocytes both at the mRNA and protein levels using an antibody (91137, Cell Signaling Technology) (Fig. 6A and fig. S7A). To rule out the possibility that the antibody we used might have a different affinity toward human and mouse PANX1, we first repeated our experiments using a second anti-PANX1 antibody (A6683, ABclonal). This antibody was raised using an immunogen that is extremely similar (96% identical in amino acid sequence) between mouse and human. Similar results were obtained using both antibodies (Fig. 6A and fig. S7B). Second, we transfected an identical amount of mouse or human PANX1 constructs (with Flag tag) into HeLa cells. Western blot analysis demonstrated that there is no significant difference (P = 0.8572) in antibody affinity for mouse and human PANX1 detected by the anti-PANX1 antibody (fig. S7C). Thus, the absence of a phenotype in our KI mice can be readily explained by the existence of a relatively low amount of PANX1 protein in their oocytes. To substantiate this conclusion, we engineered mouse lines with oocyte-specific overexpression of either WT (OE-PANX1WT) or mutant human p.Q392* (OE-PANX1Q392*) PANX1 using a Rosa26-targeted ZP3 promoter-driven KI system (fig. S8). Compared to WT controls, the total expression of PANX1 was significantly higher in OE-PANX1WT and OE-PANX1Q392* mouse oocytes (P < 0.001; Fig. 6B). Mutant PANX1 was detected in OE-PANX1Q392* mouse oocytes, and the glycosylation forms present were determined by treatment with PNGase F and Endo H (fig. S9). As expected, heterozygous OE-PANX1Q392* female mice were completely infertile, whereas OE-PANX1WT mice were normal (Fig. 6C). These findings reinforce the conclusion that a relatively low expression of PANX1 in mouse oocytes is responsible for the absence of a phenotype in KI mutant mice. To establish the precise reason for OE-PANX1Q392* female infertility, MII oocytes were collected after superovulation from 4-week-old OE-PANX1Q392* or OE-PANX1WT mice. A similar phenotype to that seen in patients was observed in OE-PANX1Q392* mice in that all superovulated oocytes died at an unknown stage, whereas MII oocytes from OE-PANX1WT mice were normal (Fig. 6D). To carefully monitor the process of oocyte death, GV oocytes free of cumulus cells were collected from OE-PANX1Q392* mice. Most were initially morphologically normal; however, after culturing for 3 hours, nearly 80% of oocytes degenerated (as manifested by cytoplasmic shrinkage) and more than 90% had died after culturing for 10 hours (Fig. 6, E and F). The phenotype could be reversed by adding CBX (Fig. 6F). This recapitulates the phenotype observed in patients with the p.Q392* mutation in family 1. In addition, uptake of lucifer yellow dye was increased, and the ATP concentration was significantly increased in the extracellular medium (P < 0.001; Fig. 6, G and H), whereas it was significantly reduced in intracellular oocytes from OE-PANX1Q392* mice (P < 0.001; fig. S10A). The abnormal ATP release could be reversed by adding CBX (Fig. 6H), consistent with the notion that aberrant channel activity results from PANX1 mutation. Last, to distinguish the defective channel property of pannexin 1 from connexin, probenecid (a selective inhibitor for pannexin 1) and either 18AGA or FFA (two selective inhibitors for connexin) were used in rescue experiments. We found that probenecid prevented the oocyte death phenotype, whereas neither 18AGA nor FFA had any effect on phenotype complementation (Fig. 6I), further demonstrating abnormal activation of the pannexin 1 rather than the connexin channel. However, although probenecid can prevent the oocyte death phenotype, none of the treated oocytes can extrude the first polar body after culturing (fig. S10, B and C), suggesting that either PANX1 has multiple roles in oocyte maturation or probenecid has side effects that impede oocyte maturation.

Fig. 6 Recapitulation of oocyte death phenotype in heterozygous OE-PANX1Q392*mice.

(A) Comparison of PANX1 protein expression in human (8) and mouse (100) oocytes. The PANX1 antibody was from Cell Signaling Technology. Data are shown as means ± SEM. Student’s t tests (n = 3 biological replicates). ***P < 0.001. (B) Comparative expression of WT (30 oocytes) or mutant (Q392*) (30 oocytes) PANX1 in oocytes from mice engineered for their overexpression. GLY1 and GLY2 bands of the full-length protein and Q392* mutant are indicated by arrows. Data are shown as means ± SEM. One-way ANOVA analysis, followed by Tukey test (n = 3 biological replicates). ***P < 0.001. (C) Statistical analysis of reproductive ability of OE-PANX1WT and OE-PANX1Q392* mice. Data are shown as means ± SEM. Student’s t tests (n = 6 biological replicates). ***P < 0.001. (D) Comparison of the status of oocytes superovulated from OE-PANX1WT and OE-PANX1Q392* mice (n = 3 biological replicates). Scale bar, 80 μm. (E) Degeneration and gradual death of OE-PANX1Q392* GV oocytes cultured in vitro. Data are shown as the means ± SEM (n = 3 biological replicates). The total number of oocytes used is listed above the bar. (F) Representative images for (E). CBX was used to inhibit oocyte death. Oocytes were cultured for 0, 3, and 10 hours. Scale bar, 80 μm. (G) Lucifer yellow uptake in oocytes from OE-PANX1WT and OE-PANX1Q392* mice. CBX was used as a PANX1 channel inhibitor. Scale bar, 80 μm. (H) Extracellular ATP content in medium containing cultured oocytes from OE-PANX1WT and OE-PANX1Q392* mice. CBX was used to inhibit oocyte death. Bars indicate the means ± SEM. One-way ANOVA analysis, followed by Tukey test (n = 6 biological replicates). ***P < 0.001. (I) Rescue experiments treating oocytes of OE-PANX1Q392* mice with selective inhibitors for pannexin 1 (probenecid) and connexin (18AGA or FFA). Oocytes were cultured for 0, 3, and 10 hours. The concentration was 3 mM for probenecid and 100 μM for 18AGA or FFA (n = 3 biological replicates). Scale bar, 80 μm.

DISCUSSION

In this study, we describe a form of familial and sporadic female infertility characterized by oocyte death. The infertility phenotype follows an autosomal dominant inheritance pattern; we found that several different heterozygous mutations in PANX1 are responsible for a similar phenotype. The mutations alter the PANX1-specific glycosylation pattern and localization in vitro. The oocyte death phenotype is associated with an abnormal form of GLY1 glycosylation, and the phenotype was recapitulated in mouse oocytes in vitro and in an engineered OE-PANX1Q392* mouse in vivo. The mutations result in abnormal PANX1 channel activation, altered membrane electrophysiological properties, and aberrant ATP release in oocytes, the effects that either alone or together cause the oocyte death phenotype.

The mutations we describe had a paternal inheritance pattern and did not affect male fertility, indicating that mutant PANX1 has a specific pathophysiological role in oogenesis but not in spermatogenesis. In addition, although PANX1 is highly expressed in the brain, patients carrying the mutations only have infertility but not brain disorders. We therefore postulate that the function of mutant PANX1 may be different in oocytes and in the brain. Four families with different mutations in PANX1 showed phenotypic variability with respect to oocyte death. The phenotype presented by the patient with a p.K346E mutation in family 2 was the most severe: Most of the oocytes were dead upon retrieval. For patients harboring mutation p.Q392* from family 1, most of the oocytes gradually degenerated after retrieval and died upon cultivation in vitro before they could be fertilized. For patients with p.C347S and p.21_23delTEP mutations, most of the MII oocytes did not die until after fertilization. We propose that this phenotypic variability might result from differential effects of the mutations. As demonstrated in our study, oocytes expressing p.K364E and p.Q392* may have a greater degree of channel activation, which in turn might cause oocyte death at an earlier stage before fertilization.

Because it is not possible to experimentally manipulate the specific glycosylation forms of PANX1 (GLY0, GLY1, and GLY2), we were unable to generate evidence to formally prove the contribution of a specific glycosylation form to the phenotype. The disease-causing mutations may not directly affect the glycosylation pattern because these sites are distant from N-glycosylation sites. Instead, these mutations may affect the glycosylation pattern and produce mutant GLY1 by a mechanism involving protein misfolding. Nonetheless, the phenotypes induced by disease-causing mutations were successfully reversed in mouse oocytes injected with double-mutant cRNAs (N255Q-Q392*, N255Q-K346E, N255Q-C347S, and N255Q-21_23delTEP). In addition, oocytes injected with both WT and mutant cRNAs only produced a GLY1 band, and mutant GLY1 also existed in OE-PANX1Q392* mouse oocytes. Moreover, although it is conceivable that abnormal GLY1 may be improperly folded, it might still be targeted to the cell membrane; this could, in itself, result in aberrant channel activation. On the basis of these considerations, we conclude that the abnormal form of GLY1 resulting from patient-derived mutations is strongly associated with the oocyte death phenotype. Together, our data justify the extension of the existing compendium of human glycosylation disorders to include this form of inherited female infertility.

Recently, a homozygous mutation (R217H) in PANX1 has been associated with multisystem dysfunction in a single patient, but a causal relationship between the mutation and clinical presentation could not be definitively established (26). Consistent with a previous study (26), our results indicate that R217H does not cause changes in PANX1 glycosylation, subcellular localization, or the corresponding phenotypes. Previous studies have described normal fertility in Panx1 knockout mice (3235). In this study, we also observed normal fertility in four heterozygous KI mutant mice, whereas heterozygous OE-PANX1Q392* mice demonstrated infertility caused by oocyte death. In addition, all mutations activated the channel. Together, we interpret our data in terms of a gain-of-function effect incurred by the mutations we describe, in which the phenotype is modulated by a dosage effect.

This study has some limitations. First, we have not figured out the exact molecular mechanism on how fertilization accelerated the death of oocytes expressing mutant C347S or 21_23delTEP. This may be further investigated by using OE-PANX1C347S mice. Second, although probenecid can rescue the OE-PANX1Q392* oocytes from death phenotype, these oocytes cannot extrude the first polar body, making it impossible to produce live pups. This result suggests that either PANX1 has multiple (and unknown) roles in oocyte maturation or probenecid has side effects that impede oocyte maturation, and this will need to be addressed with additional experiments. In conclusion, our findings demonstrate the critical role of PANX1 in human oocyte development, identify a cause of female infertility, and suggest a potential target for therapeutic intervention for the disease.

MATERIALS AND METHODS

Study design

The overall objectives of the study were to identify genetic causes for a form of familial or sporadic female infertility that we referred to as oocyte death and to study its pathological mechanism. We found four different heterozygous mutations in PANX1 responsible for the phenotype in four independent families. No randomization was performed for the human studies. To establish a causal relationship between PANX1 mutations and the oocyte death phenotype, WT or mutant PANX1 cRNAs were microinjected into mouse GV oocytes to mimic the oocyte death phenotype. To detect the pathogenic mechanism of mutations, we explored the expression and glycosylation patterns of WT and mutated PANX1 proteins. To investigate the association between the altered glycosylation pattern and the oocyte death phenotype, we introduced three predicted N-glycosylation sites in human WT PANX1 (N255Q, N338Q, and N394Q) and analyzed their expression patterns. To determine whether the identified mutations cause the oocyte death phenotype by altering channel activity, we monitored the channel activity of WT and mutant cRNAs in X. laevis oocytes with or without CBX, a channel inhibitor. To evaluate the effect of PANX1 mutations on female fertility in vivo, we generated PANX1 KI mice and overexpression mice to mimic the phenotype in vivo and evaluate their fertility. To further confirm the activation of the PANX1 channel, we used the specific inhibitor probenecid for a rescue experiment. Blinding was performed for in vitro oocyte death recapitulation. Oocytes were randomized to injection with WT or mutant cRNAs, and investigators collecting the data were blinded to the groups. No other blinding was performed. Experimental replicates and numbers of mice used for fertility evaluation were variable in different experiments and are specified in the figure legends.

Human subjects

Familial and sporadic infertility patients and healthy controls were recruited from the Reproductive Medicine Center of the Shanghai Ninth Hospital affiliated with Shanghai Jiao Tong University and the Reproductive Medicine Center of the Shaanxi Maternal and Child Care Service Center. Studies of human subjects were approved by the Fudan University Medicine Institutional Review Board. All oocytes from controls and patients were obtained with written informed consent signed by the donor couples. The study was approved by the Reproductive Study Ethics Committee of the Shanghai Ninth Hospital affiliated with Shanghai Jiao Tong University.

Whole-exome sequencing, data analysis, and target gene sequencing

All genomic DNA samples from patients and their family members were extracted from peripheral leukocytes. Exome captures were performed with the Agilent SureSelect Whole Exome Enrichment Kit, and sequencing was performed on an Illumina sequencing platform using standard protocols (36). A variant was considered to be a candidate mutation if (i) it was shared by all affected individuals; (ii) it was not previously reported or was reported to have a frequency below 0.1% in four public databases including 1000 Genomes, the NHLBI Exome Sequencing Project Exome Variant Server, the Exome Aggregation Consortium Browser, and our in-house database of exome variants of 200 healthy controls; and (iii) it corresponded to a gene expressed in human oocytes or early embryos according to the public database of transcriptome profiles (37). Sanger sequencing was performed to verify mutations of PANX1 in all patients. Primers used for PANX1 exon sequencing were provided in table S1.

PANX1 expression analysis and immunofluorescence

Total RNA from human GV, MI and MII oocytes, day 3 embryos, blastocysts, granulosa cells, and other somatic tissues (including heart, liver, spleen, lung, kidney, brain, and spinal cord) were extracted according to a previously published protocol (38). Expression of PANX1 was analyzed by qRT-PCR, and the results were normalized by comparison to the expression of an internal GAPDH control. Human oocytes at different stages of maturation were fixed and stained, as described previously (36). Briefly, oocytes were incubated with an anti-PANX1 antibody (Sigma-Aldrich) to determine its localization. At the same time, oocytes were incubated with an anti–α-tubulin antibody and DAPI for labeling spindles and DNA, respectively. Oocytes were mounted on glass slides and examined with a confocal laser scanning microscope (Leica). Primers used for qRT-PCR were provided in table S1.

Expression constructs, transfection, and Western blotting

Full-length coding sequence encoding human PANX1 (NM_015368.4) or mouse Panx1 (NM_019482.2) was amplified and cloned into the PCMV6-entry vector containing an engineered stop codon to express untagged proteins. Mutations in PANX1 [c.61_69delACGGAGCCC (21_23delTEP), c.650G > A (R217), c.814A > G (I272V), c.1036A > G (K346E), c.1040G > C (C347S), and c.1174C > T (Q392*)] were introduced using the site-directed KOD-Plus-Mutagenesis Kit (Toyobo Life Science) according to the manufacturer’s instructions. For N255Q, N338Q, and N394Q mutations in PANX1, c.763_765 AAC, c.1012_ 1014 AAT, and c.1180_ 1182AAC were mutated to c.763_765 CAA, c.1012_ 1014 CAA, and c.1180_ 1182 CAA .

A HeLa cell line was obtained from the Cell Bank of Shanghai Institute for Biological Sciences, the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in high-glucose Dulbecco’s minimum essential medium (Gibco) supplemented with 1% penicillin/streptomycin and 10% (v/v) fetal bovine serum (FBS; Gibco), maintained at 37°C in a humidified 5% CO2 incubator. Cells were plated 18 to 24 hours before transfection and maintained until the cell density reached 70 to ~80% confluence. Before transfection, fresh complete culture medium containing serum and antibiotics was added to each well. After 30 to 60 min, cell transfection was performed using the PolyJet In Vitro DNA Transfection Reagent (SignaGen) according to a standard protocol. HeLa cells were harvested 36 hours after transfection and washed three times with cold phosphate-buffered saline (PBS). Total protein was extracted using radioimmunoprecipitation assay lysis buffer (Shanghai Wei AO Biological). After quantification with the bicinchoninic acid (BCA) assay (Shanghai Biocolor BioScience & Technology Co.), cell extracts were denatured by boiling for 10 min in SDS loading buffer, resolved by SDS–polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose membranes (Pall Corporation), and probed with rabbit anti-PANX1 (1:1000 dilution; Cell Signaling Technology) or mouse anti-vinculin (1:5000 dilution; Sigma-Aldrich) antibodies. The secondary antibodies used were goat anti-rabbit immunoglobulin G (IgG) (1:5000 dilution; Abmart) or goat anti-mouse IgG (1:5000 dilution; Abmart) conjugated to horseradish peroxidase.

Cell surface biotinylation assay

A cell surface biotinylation assay was performed, as described previously (39). Briefly, HeLa cells transfected with the indicated plasmids were washed three times with cold PBS and incubated at 4°C with sulfo-NHS-SS-Biotin (1 mg/ml; Pierce) in PBS for 30 min. Cultures were washed with PBS and incubated in 100 mM glycine in PBS buffer for 15 min at 4°C to quench the biotin. Cells were lysed in immunoprecipitation (IP) lysis buffer for 30 min at 4°C, followed by centrifugation at 14,000g at 4°C for 20 min to obtain the supernatant. The concentration of the extracted protein was quantified using the BCA assay (Shanghai Biocolor BioScience & Technology Co.). Equal amounts of lysate protein from cells transfected with WT and mutant constructs were incubated overnight with 20 μl of NeutrAvidin agarose beads (Pierce Chemical). The cell lysate was centrifuged at 14,000g for 5 min, and the supernatant containing cytoplasmic proteins was retained. Beads were washed in IP lysis buffer five times at 4°C and then denatured by boiling for 5 min in 20 μl 1× SDS loading buffer. Denatured lysates were separated by electrophoresis on 10% SDS-PAGE, transferred to nitrocellulose membranes (Pall Corporation), and probed with rabbit anti-PANX1 (1:1000 dilution; Sigma-Aldrich) or mouse anti-vinculin (1:5000 dilution; Sigma-Aldrich) antibodies. The secondary antibodies were goat anti-rabbit IgG (1:5000 dilution; Abmart) or goat anti-mouse IgG (1:5000 dilution; Abmart) conjugated to horseradish peroxidase.

Mouse oocyte collection, cRNA transcription, and microinjection

Ovaries were isolated from 6- to 8-week-old female ICR (Institute of Cancer Research) mice (Beijing Vital River Laboratory Animal Technology Co.). GV oocytes were isolated from ovaries by puncturing the antral follicles with a fine needle on the stage of a dissecting microscope, and the GV oocytes were cultured in M2 medium (Sigma-Aldrich) with 10% FBS.

WT and mutant-bearing plasmids were linearized by digestion with the AgeI restriction enzyme (R0552S, New England BioLabs) at 37°C for 3 hours. After purification, 1 μg of linearized DNA was used as a template to transcribe PANX1 cRNA, followed by deoxyribonuclease (DNase) I treatment and polyadenylate [poly(A)] tailing using the HiScribe T7 ARCA mRNA Kit (E2060S, New England BioLabs). The RNeasy MinElute Cleanup Kit (74204, Qiagen) was used to purify target cRNAs.

GV oocytes were microinjected with WT or mutant cRNAs using a Leica Hoffman microscope (LSM6000) equipped with a TransferMan NK2 micromanipulator and InjectMan NI2 (Eppendorf). About 5 to 10 pl of cRNA solution (50 to 200 ng/μl) was microinjected into the cytoplasm of each mouse GV oocyte. Injected GV oocytes were matured in vitro in M16 medium (Sigma-Aldrich) containing 10% FBS for 12 hours. Then, mature oocytes were collected and mixed with sperm in Human Tubal Fluid medium (Millipore) for fertilization. All oocytes were cultured at 37°C in an atmosphere of 5% CO2. For PANX1 channel inhibition experiments, CBX was used at a concentration of 300 μM. All experimental protocols for mice were reviewed and approved by the Shanghai Medical College of Fudan University.

Two-electrode voltage clamp electrophysiology

PANX1 channels were expressed in X. laevis oocytes (Nasco) by injection of about 40 nl of WT or mutant cRNAs, including C347S, Q392*, 21_23delTEP, and K346E (at 150 ng/μl each). Eighteen hours after injection, a two-electrode voltage clamp was performed in the standard external solution containing 90 mM NaCl, 2 mM KCl, 2 mM CaCl2, 1 mM MgCl2, and 5 mM Hepes, with or without 10 μM CBX (Sigma-Aldrich). The pH was adjusted to 7.4 with KOH. The membrane potential was initially held at −60 mV for 100 ms and then changed from −100 to +60 mV in steps of 20 mV by 2-s ramps. Data were collected and analyzed using pClamp 10 (Molecular Devices) and fitted in GraphPad Prism. Error bars represent the SD of the mean value.

ATP measurements

GV oocytes or 2 PN zygotes were cultured in 80 μl of medium containing 300 μM ARL 67156 trisodium (Sigma-Aldrich) and collected at 6 hours after injection with WT or mutant cRNAs. The relative ATP content was determined with the ATP Bioluminescence Assay Kit according to the manufacturer’s instructions (ATP Bioluminescence Assay Kit HS II, Roche Applied Science). Briefly, for extracellular ATP measurements, a mixture of 60 μl of culture medium and 60 μl of luciferine-luciferase was assayed using a luminometer (Luminoskan TL Plus, Thermo LabSystems). For intracellular ATP measurement, 20 GV oocytes or zygotes per group were lysed with 400 μl of lysis buffer for 10 min and centrifuged at 4000g at room temperature for 30 s. A mixture of 60 μl of supernatant and 60 μl of luciferine-luciferase was assayed, as described above. The relative ATP concentration was expressed as a ratio of all values with respect to the WT group.

Generation of point mutation KI or overexpression mice

Q392* mutation KI mouse. To produce a Cas9 mRNA, single guide RNA (sgRNA), and donor oligo, a T7 promoter was first fused to the Cas9 coding region of the px330 plasmid by PCR amplification. The T7-Cas9 PCR product was purified and used as a template for in vitro transcription (IVT) using the mMESSAGE mMACHINE T7 ULTRA Kit (Life Technologies). A T7 promoter was fused to the sgRNA template by PCR amplification, and the T7-sgRNA PCR product was purified and used as a template for IVT using the MEGAshortscript T7 Kit (Life Technologies). Both the Cas9 mRNA and the sgRNAs were purified using a MEGAclear kit (Life Technologies) and eluted in RNase-free water. Oligo donors with 123–base pair (bp) (for Q392*, C347S, and K346E) or 100-bp (for 21_23delTEP) homology to sequences on both sides of the mutation site were obtained as ultramer DNA oligos from GenScript Corporation. The oligos contained a CAG-to-TAG mutation for Q392*, a TCT-to-TGT mutation for C346S, a GAG-to-AAG mutation for K346E, and an ACCGAGCCC deletion for 21_23delTEP. Female C57BL/6 mice (Beijing Vital River Laboratory Animal Technology Co.) were superovulated by injecting 8 IU of pregnant mare serum gonadotropin (Ningbo Second Hormone Factory), followed 48 hours later by injection of 8 IU of human chorionic gonadotropin (Ningbo Second Hormone Factory). They were then mated to C57BL/6 males, and fertilized embryos were collected from the oviducts. Cas9 mRNA (100 ng/μl), sgRNAs (50 ng/μl), and donor oligo (100 ng/μl) were mixed and injected into the cytoplasm of fertilized eggs using an IM300 microinjector (Narishige). About 30 injected single-cell embryos were transferred into the oviducts of pseudopregnant ICR females at 0.5 days after coitus. For the identification of Panx1 point mutation founders, DNA was extracted and the target fragment was amplified. PCR products from each mouse were cloned with a TA cloning kit (TIANGEN) according to the manufacturer’s instructions. Sanger sequencing was used to confirm Panx1 mutation founders.

Q392* mutation overexpression mice (constructed by Cyagen Biosciences). These mice were generated using CRISPR-Cas9–mediated homologous recombination. The guide RNA (sequence: CTCCAGTCTTTCTAGAAGATGGG) targeted to the mouse Rosa26 gene intron 1, a linearized donor vector containing the ZP3-human WT or mutant PANX1 (C1174T) cDNA poly(A) cassette, and the Cas9 mRNA were coinjected into fertilized mouse eggs to generate targeted KI offspring. F0 founder animals were identified by PCR followed by sequence analysis and were bred to WT mice to test germline transmission and F1 animal generation. Primers used for mouse genotyping were provided in table S1.

Statistical analyses

Statistical analysis was performed using GraphPad. Values were analyzed by Student’s t tests for two experimental groups or by one-way ANOVA, followed by Tukey test for more than two groups. GraphPad style was used for evaluating significance as follows: *P < 0.05, **P < 0.01, ***P < 0.001. Original data are provided in data file S1.

SUPPLEMENTARY MATERIALS

www.sciencetranslationalmedicine.org/cgi/content/full/11/485/eaav8731/DC1

Fig. S1. Existence of GLY1 in mutant PANX1 and effect of mutations on cellular localization of PANX1 in HeLa cells.

Fig. S2. Effects of R217H and I272V on oocyte survival and effects of C347S and 21_23delTEP on zygote survival.

Fig. S3. Association of oocyte death phenotype with mutant GLY1 bands.

Fig. S4. Decrease of the maximum current by application of CBX measured at +60 mV.

Fig. S5. Measurement of intracellular ATP content in oocytes or zygotes injected with WT or mutant PANX1 cRNA.

Fig. S6. Scheme for generation of human mutant PANX1 KI mice and evaluation of their fertility.

Fig. S7. Comparison of PANX1 expression in human and mouse oocytes.

Fig. S8. Schematic strategy for targeted integration of human PANX1 gene at the mouse ROSA26 locus.

Fig. S9. Effect of PNGase F and Endo H treatment on PANX1 glycosylation in oocytes from OE- PANX1WT and OE-PANX1Q392* mice.

Fig. S10. Intracellular ATP measurement in oocytes from OE-PANX1WT and OE-PANX1Q392* mice and the effect of probenecid on OE-PANX1Q392* oocyte maturation.

Table S1. Primers used for PANX1 exon sequencing, mouse genotyping, and qRT-PCR.

Table S2. Numbers of oocytes used in Fig. 4 (C, D, and F).

Data file S1. Primary data.

REFERENCES AND NOTES

Acknowledgments: We thank N. Cowan (New York Langone University Medical Center) for reviewing the manuscript; all the clinical staff for participating in collecting patient samples; the patients for participating in this study; Z. Sun for providing the microinjection equipment; and K. Qiao for conducting oocyte imaging using laser confocal microscope. Funding: This work was supported by the National Key Research and Development Program of China (2017YFC1001500, 2016YFC1000600, and 2018YFC1003800), the National Basic Research Program of China (2015CB943300), the National Natural Science Foundation of China (81725006, 81822019, 81771581, 81771649, and 81571501), the Shanghai Rising Star Program (17QA1400200), the Natural Science Foundation of Shanghai (17ZR1401900), and the Foundation of Shanghai Health and Family Planning Commission (20154Y0162). Author contributions: L. Wang and Q. Sang conceived the study and wrote the draft of this manuscript. Y.K., J.S., B.L., Z.Y., A.A., L. Wu, X.M., S.X., and Q. Lyu contributed to the recruitment, characterization, and oocyte imaging of the patients. Q. Sang and J.M. performed the in vivo and in vitro experiments for phenotype recapitulation. Z.Z. performed the biochemical experiments. X.S., B.C., and Q. Li contributed to the bioinformatics analysis. S.Z., W.L., and J.Z. participated in the two-electrode voltage clamp electrophysiology experiment. X.S. and Q. Sun contributed to the construction of mutant Panx1 KI mice. X.S. and J.D. provided the mouse keeping room. X.S., L.J., and L.H. helped in editing and improving the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data associated with this study are present in the paper and/or the Supplementary Materials.
View Abstract

Stay Connected to Science Translational Medicine

Navigate This Article