Research ArticleHuntington’s Disease

Huntingtin suppression restores cognitive function in a mouse model of Huntington’s disease

See allHide authors and affiliations

Science Translational Medicine  03 Oct 2018:
Vol. 10, Issue 461, eaar3959
DOI: 10.1126/scitranslmed.aar3959
  • Fig. 1 muHTT and hHTT ASOs reduce HTT protein concentration in the brain.

    Quantification of (A) muHTT and (B) wtHTT in the anterior forebrain of both hemispheres from Hu97/18 mice (n = 2, four measurements) treated with ASO or PBS at 6 weeks of age at the indicated collection ages using allelic separation immunoblotting. HTT protein densities (wt or mu) were normalized to the mean value in PBS-treated animals of the same age to determine the percentage of HTT protein remaining after ASO treatment. *Different from PBS treatment for same allele using least mean squares analysis; ns, not significant; *P < 0.05, **P < 0.01, ***P < 0.001.

  • Fig. 2 muHTT suppression rescues cognitive deficits.

    Schematic representation of (A) the NOL learning assay and (B) the NOP learning assay performed at 9 months of age in mice. (C) Bar graph showing the percentage of time spent investigating the target (novel position) object in Hu18/18 and Hu97/18 mice after early treatment with PBS or the different ASOs indicated in the figure. (D) Bar graph showing the percentage of time spent investigating the target (novel object) object in Hu18/18 and Hu97/18 mice after early treatment with PBS or the different ASOs indicated in the figure. (E) Bar graph showing the percentage of time spent investigating the target (novel position) object in Hu18/18 and Hu97/18 mice after late treatment with PBS or the different ASOs indicated in the figure. (F) Bar graph showing the percentage of time spent investigating the target (novel object) object in Hu18/18 and Hu97/18 mice after late treatment with PBS or the different ASOs indicated in the figure. Asterisk (*) indicates difference from PBS Hu97/18 for trial difference versus treatment solution for fixed-effects analysis at P < 0.05.

  • Fig. 3 muHTT suppression normalizes anxiety behavior.

    Anxiety-like behavior was assessed during (A to D) a 10-min exploration of a brightly lit open field at the indicated ages or (E and F) a 5-min exploration of an elevated plus maze at 6 months of age in the animal groups indicated in figure. (A) Entries into and (B) time spent in the center of the open field in Hu18/18 and Hu97/18 mice treated early with PBS or with the ASOs indicated in the figure. (C) Entries into and (D) time spent in the center of the open field in Hu18/18 and Hu97/18 mice treated late with PBS or with the ASOs indicated in the figure. (E) Entries into and (F) total time spent in the open arms of the elevated plus maze in Hu18/18 and Hu97/18 mice treated early with PBS or with the ASOs indicated in the figure. Asterisk (*) indicates difference between PBS Hu97/18 and PBS Hu18/18, and “#” indicates difference from PBS Hu97/18 by differences of least mean squares. *P < 0.05, **P < 0.01, ***P < 0.001.

  • Fig. 4 muHTT suppression may ameliorate depressive behavior.

    Depressive-like behavior was assessed at 12 months of age after early (A) and late (B) intervention in the animal groups indicated in figure by measuring the time spent immobile during the final 5 min of a 6-min forced swim. Asterisk (*) indicates difference between PBS Hu97/18 by differences of least mean squares. *P < 0.05, **P < 0.01.

  • Fig. 5 muHTT suppression ameliorates aspects of forebrain atrophy and increases striatal DARPP-32.

    Neuropathology and brain histology were performed at 12 months of age after ASO treatment at 6 weeks or 6 months of age. Bar graphs showing the effect of early (A, C, E, and G) and late (B, D, F, and H) PBS or ASO treatment on weight of postperfusion forebrains (A and B), stereological cortical volume (C and D), stereological striatal volume (E and F), and striatal DARPP-32 immunoreactivity (G and H) in Hu18/18 and Hu97/18 mice treated with PBS or with the different ASOs indicated in the figure. Asterisk (*) indicates difference between PBS Hu97/18 and PBS Hu18/18, and “#” indicates difference from PBS Hu97/18 by differences of least mean squares analysis. *P < 0.05, **P < 0.01. IOD, integrated optical density.

  • Fig. 6 HTT suppression in cortical and limbic structures in the NHP brain.

    (A) Schematic of study design. Cynomolgus monkeys received weekly LP delivery of NHP HTT ASOs (NHTT1 or NHHT2) or vehicle (aCSF). Tissue is collected 4 weeks after the final dose. (B) Drug concentration in spinal cord and cortex. (C) Monkey HTT mRNA in spinal cord and cortical and limbic regions quantified by quantitative polymerase chain reaction and expressed as means ± SEM percentage (%) of HTT relative to vehicle-treated controls. Asterisk (*P < 0.05, **P < 0.01, ***P < 0.001) denotes statistically significant differences, with changes relative to same region aCSF [one-way analysis of variance (ANOVA) and Dunnett’s multiple comparison tests].

  • Table 1 Summary of ASOs.

    Black, PS; yellow, MOE; blue, cEt. Target SNP is underlined for allele-selective ASOs. NHP, nonhuman primate.

    TargetASOSequence/design
    hHTThHTT (HH1)CTCAGTAACATTGACACCAC
    rs7685686 (A)muHTT1 (A16)ATAAATTGTCATCACC
    muHTT2 (A21)TAAATTGTCATCACC
    rs6446723 (G)muHTT3 (G1)TAATTTTCTAGACTTTA
    NHP HTTnHTT1CGAGACAGTCGCTTCCACTT
    nHTT2TCTCTATTGCACATTCCA

Supplementary Materials

  • www.sciencetranslationalmedicine.org/cgi/content/full/10/461/eaar3959/DC1

    Methods

    Fig. S1. Mechanism of ASO-mediated SNP-targeted allele-specific muHTT suppression.

    Fig. S2. Experimental design.

    Fig. S3. ASO tolerability.

    Fig. S4. Comparison of HTT protein at 10 months of age in early- and late-intervention groups.

    Fig. S5. Body weight.

    Fig. S6. Accelerating rotarod.

    Fig. S7. Spontaneous climbing.

    Fig. S8. Total object investigation time during NOL trial 1.

    Fig. S9. Supplementary open-field exploration.

    Fig. S10. Supplementary elevated plus maze exploration.

    Fig. S11. Cerebellum weight.

    Table S1. Linear mixed-effect models analysis HTT protein levels.

    Table S2. Linear mixed-effect models analysis: Early intervention.

    Table S3. Linear mixed-effect models analysis: Late intervention.

    Table S4. ANOVAs with multiple-comparison correction: Early intervention.

    Table S5. ANOVAs with multiple-comparison correction: Late intervention.

    Table S6. Raw data (Excel file).

  • The PDF file includes:

    • Methods
    • Fig. S1. Mechanism of ASO-mediated SNP-targeted allele-specific muHTT suppression.
    • Fig. S2. Experimental design.
    • Fig. S3. ASO tolerability.
    • Fig. S4. Comparison of HTT protein at 10 months of age in early- and late-intervention groups.
    • Fig. S5. Body weight.
    • Fig. S6. Accelerating rotarod.
    • Fig. S7. Spontaneous climbing.
    • Fig. S8. Total object investigation time during NOL trial 1.
    • Fig. S9. Supplementary open-field exploration.
    • Fig. S10. Supplementary elevated plus maze exploration.
    • Fig. S11. Cerebellum weight.
    • Table S1. Linear mixed-effect models analysis: HTT protein levels.
    • Table S2. Linear mixed-effect models analysis: Early intervention.
    • Table S3. Linear mixed-effect models analysis: Late intervention.
    • Table S4. ANOVAs with multiple-comparison correction: Early intervention.
    • Table S5. ANOVAs with multiple-comparison correction: Late intervention.

    [Download PDF]

    Other Supplementary Material for this manuscript includes the following:

Stay Connected to Science Translational Medicine

Navigate This Article