Research ArticleCancer

Targeting the XPO1-dependent nuclear export of E2F7 reverses anthracycline resistance in head and neck squamous cell carcinomas

See allHide authors and affiliations

Science Translational Medicine  27 Jun 2018:
Vol. 10, Issue 447, eaar7223
DOI: 10.1126/scitranslmed.aar7223

Restoring balance in the nucleus

Despite recent advances in cancer treatment, resistance to cancer therapy and resulting mortality remain common in head and neck squamous cell carcinoma. In their search for the causes of treatment resistance, Saenz-Ponce et al. identified a mechanism dependent on the balance of two proteins that regulate transcription and these proteins’ localization within cancer cells. Specifically, the authors discovered that a transcriptional inhibitor called E2F7 is frequently mislocalized to the cytoplasm in these tumors, whereas its transcription-activating counterpart, E2F1, remains in the nucleus and drives transcription of treatment resistance genes. The authors also identified an approved drug that can prevent the export of E2F7 from the nucleus and thereby restore the efficacy of anthracycline chemotherapy in head and neck cancer.

Abstract

Patient mortality rates have remained stubbornly high (40%) for the past 35 years in head and neck squamous cell carcinoma (HNSCC) due to inherent or acquired drug resistance. Thus, a critical issue in advanced SCC is to identify and target the mechanisms that contribute to therapy resistance. We report that the transcriptional inhibitor, E2F7, is mislocalized to the cytoplasm in >80% of human HNSCCs, whereas the transcriptional activator, E2F1, retains localization to the nucleus in SCC. This results in an imbalance in the control of E2F-dependent targets such as SPHK1, which is derepressed and drives resistance to anthracyclines in HNSCC. Specifically, we show that (i) E2F7 is subject to exportin 1 (XPO1)–dependent nuclear export, (ii) E2F7 is selectively mislocalized in most of SCC and multiple other tumor types, (iii) mislocalization of E2F7 in HNSCC causes derepression of Sphk1 and drives anthracycline resistance, and (iv) anthracycline resistance can be reversed with a clinically available inhibitor of XPO1, selinexor, in xenotransplant models of HNSCC. Thus, we have identified a strategy to repurpose anthracyclines for use in SCC. More generally, we provide a strategy to restore the balance of E2F1 (activator) and E2F7 (inhibitor) activity in cancer.

INTRODUCTION

Cancers arising from stratified squamous epithelial linings of the upper aerodigestive tract [head and neck squamous cell carcinomas (HNSCCs)] are among the most common cancers globally and are caused by exposure to exogenous carcinogens such as tobacco smoke or excessive alcohol consumption and/or human papillomavirus infection (1, 2). On a global scale, there are about 640,000 new cases of HNSCC diagnosed each year (3). Tumors which display no evidence of local, regional, or distant spread are associated with high cure rates after surgery and/or radiation (4). Unfortunately, if the disease progresses and spreads to local, regional, and distant sites, then it is associated with an increasingly poor prognosis (4, 5). In this context, treatment failure and patient mortality rates have remained stubbornly high (40%) for the past 35 years in HNSCC patients (3, 6). This high mortality rate can be attributed to inherent or acquired resistance to chemotherapeutics used for HNSCC (platinum-based drugs, taxanes, epidermal growth factor receptor–targeting therapeutic antibodies, and 5-fluorouracil) (7, 8). Thus, a critical issue in advanced SCC is to identify and target mechanisms that contribute to therapy resistance.

Recent studies have shown that the E2F transcription factor family is key regulators of chemotherapeutic sensitivity and in particular sensitivity to anthracyclines (9, 10). The E2F transcription factor family is composed of 8 genes encoding 10 gene products, which bind a consensus E2F response element (TTTSSCGC). E2F family members are classified as transcriptional activators (E2F1, E2F2, and E2F3a) or inhibitors (E2F3b, E2F4, E2F5, E2F6, E2F7a, E2F7b, and E2F8) and are important regulators of proliferation, differentiation, survival, apoptosis, and DNA damage responses (1114). Many of the functions of the E2F family are context-specific. For example, E2F1 has been shown to have both tumor-suppressive and oncogenic activity, depending on the tissue context (1517). This apparent paradox most likely reflects the dominant activity of E2F1 in apoptosis or proliferation depending on the tissue context.

In the context of unperturbed primary cultures of human keratinocytes derived from a stratified epithelium (epidermis), transient overexpression of E2F1 is sufficient to induce apoptosis, which can be antagonized by transient overexpression of E2F7 (18, 19). However, in ultraviolet-irradiated mice, E2F1 displays antiapoptotic and tumor-suppressive properties, whereas overexpression in a transgenic mouse model results in constitutively higher rates of apoptosis and is oncogenic (20, 21). Recently, Thurlings et al. (22) showed that E2F1 ablation in the context of mouse keratinocytes was neither oncogenic nor tumor suppressive in a “skin painting” model of carcinogenesis. However, E2F1 ablation combined with E2F7 and E2F8 ablation resulted in increased tumor numbers, suggesting a tumor-suppressive role (22). These studies reinforce the critical importance of considering tissue and cellular context when interpreting E2F action. Here, we have focused on the mechanism of E2F-dependent anthracycline resistance in the context of human HNSCC.

Earlier studies have shown that E2F regulates sensitivity to a number of conventional chemotherapeutics (9). In particular, E2F activity drives resistance to anthracyclines in SCC cell lines in vitro and in vivo (9, 10). This resistance is induced by the overexpression/activation of the interdependent sphingosine kinase-1 (SPHK1) and Rac GTPase activating protein 1 (RACGAP1) pathways. Both RACGAP1 and SPHK1 are direct transcriptional targets of E2F7, and a causative contribution to anthracycline resistance was shown by genetic knockdown, overexpression, and pharmacological inhibition in vitro and in vivo (9, 10). Moreover, interrogation of human tissue microarrays (TMAs) of HNSCC patients showed that E2F7, SPHK1, and RACGAP1 were overexpressed in human SCC and were linked to a poor prognosis (12). Finally, it was shown that anthracycline resistance was driven by the increase in sphingosine-1-phosphate (S1P) that results from the conversion of sphingosine to S1P by SPHK1 (9, 10). Thus, anthracycline resistance was driven by E2F in an S1P-dependent manner in HNSCC. This was consistent with the literature demonstrating that sphingolipids can regulate proliferation, differentiation, invasion, and apoptotic responses in cancer cells (2325). Thus, SPHK1 is a key enzyme controlling cytotoxic responses in cancer cells (9). The translational relevance of this is highlighted by reports that a combination of doxorubicin plus a SPHK1 inhibitor caused tumor regression in a xenotransplant model of SCC (9, 10).

Although the above findings suggest a link between E2F activity and SPHK1/S1P-dependent anthracycline resistance, the relationship and mechanism controlling this pathway remain unresolved. For example, E2F1 and E2F7 are both overexpressed in most of HNSCCs and are mutually antagonistic (26). Therefore, we considered the proposition that the increase in E2F-dependent SPHK1 transcription may be due to a pathological imbalance in the ratio of activating E2F1 to inhibitory E2F7 in HNSCC. Consistent with this, we report that, in greater than 80% of HNSCCs, there is a selective relocation of E2F7 from the nucleus to the cytoplasm. We show that this mislocalization is due to exportin 1 (XPO1; also known as chromosomal maintenance 1 or CRM1)–dependent export of E2F7 from the nucleus resulting in derepression of SPHK1. Finally, we show that pharmacological inhibition of XPO1 reverses the E2F7 pathology and anthracycline resistance in cell line and patient xenotransplant models of HNSCC.

RESULTS

The opposing actions of E2F1 and E2F7 control SPHK1 expression and doxorubicin resistance

We previously identified the SPHK1/S1P pathway as a downstream effector of E2F-dependent resistance to anthracyclines such as doxorubicin (9, 10). However, it was not determined whether SPHK1 transcription was the result of mutual antagonism between the activating E2F1 and the inhibitory E2F7. To address this, we used a suite of human SCC cell lines that differed in their inherent sensitivity/resistance to doxorubicin (9). We transfected doxorubicin-sensitive cell lines, KJDSV40 [half maximal effective concentration (EC50) = 0.1 μM] and FaDu (EC50 = 0.2 μM), and doxorubicin-resistant cell lines, SCC25 (EC50 = 1.1 μM) and Detroit562 (EC50 = 1.2 μM), with small interfering RNA (siRNA) targeting E2F1 or E2F7. We achieved a knockdown greater than 70% for the E2F7 protein (Fig. 1A and fig. S1A) and 45% for the E2F1 protein (Fig. 1B and fig. S1B) with their cognate siRNAs compared to cells transfected with vehicle or a scrambled control. Treatment with E2F7 siRNA significantly enhanced SPHK1 protein expression (P < 0.01; Fig. 1, C and D), whereas treatment with E2F1 siRNA significantly reduced SPHK1 protein expression compared to controls (P < 0.05; Fig. 1, C and E). A similar result was observed for the expression of SPHK1 mRNA in the SCC25 cell line (fig. S2) as was observed for SPHK1 protein. Finally, as shown by the expression of the apoptotic marker cleaved caspase-3, E2F7 depletion significantly reduced doxorubicin cytotoxicity (P < 0.05; Fig. 1, F and G), whereas E2F1 depletion significantly increased doxorubicin cytotoxicity (P < 0.05; Fig. 1, F and H). These data indicate that E2F7 represses SPHK1 expression and increases sensitivity to doxorubicin, whereas E2F1 induces SPHK1 expression and induces doxorubicin resistance in all the tested SCC cell lines. These data show that SPHK1 expression and doxorubicin sensitivity are regulated by the opposing actions of E2F1 and E2F7.

Fig. 1 The opposing transcriptional actions of E2F1 and E2F7 control SPHK1 expression and doxorubicin resistance in normal tissue and SCC cell lines.

(A and B) The efficacy of E2F7 or E2F1-targeting siRNAs at knocking down the expression of their cognate targets in KJDSV40 (abbreviated as KJD), FaDu, SCC25, and Detroit562 (abbreviated as Detroit) cells was analyzed by quantitative Western blot analysis of E2F7 (A) and E2F1 (B) proteins. E2F1 and E2F7 expression was normalized to β-actin in all instances. Quantitative data presented as means ± SEM of triplicate determinations of two biological replicates. (C to E) Representative Western blot (C) and (D and E) quantitative analysis of KJD, FaDu, SCC25, and Detroit cells treated with (i) vehicle [1:100 dilution dimethyl sulfoxide (DMSO)], (ii) control β-galactosidase (β-gal) siRNA, (iii) E2F7-targeting siRNA (D), or (iv) E2F1-targeting siRNA (E) for 48 hours, showing the expression of SPHK1. Normalization and quantitation were performed as described in (A). (F to H) Representative Western blot (F) and (G and H) quantitative analysis of cleaved caspase-3 in KJD, FaDu, SCC25, and Detroit cells treated with (i) vehicle (1:100 dilution DMSO), (ii) control β-galactosidase siRNA + 1 μM doxorubicin, (iii) E2F7-targeting siRNA + 1 μM doxorubicin (G), or (iv) E2F1-targeting siRNA + 1 μM doxorubicin (H) for 48 hours. Total caspase-3 was used to normalize for changes in expression of cleaved caspase-3. (I) ChIP analysis of E2F1 and E2F7 binding to the SPHK1 promoter in HEKs and SCC25 cells. Nonimmune immunoglobulin G (IgG) was used as control. Quantitative data represent means ± range of two biological replicates. (J and K) Representative Western blot (J) and quantitative analysis (K) of total extracts of proliferating HEKs and SCC25 cells. Expression was plotted as E2F7/E2F1 ratio and was normalized to β-actin. (L) IF analysis showing the intracellular localization of E2F7 and E2F1 in proliferating HEKs and SCC25 cells. Images are representative of at least three replicates. An unpaired t test was used to compare values of treatment groups to their respective vehicle-treated group. *P < 0.05, **P < 0.01, and ***P < 0.001. DAPI, 4′,6-diamidino-2-phenylindole.

Chromatin immunoprecipitation (ChIP) analysis of extracts from normal human epidermal keratinocytes (HEKs) and the doxorubicin-resistant SCC25 cells showed that E2F1 and E2F7 could bind the E2F response element within the SPHK1 promoter (Fig. 1I). These data show that SPHK1 is a direct transcriptional target of the activating E2F1 and the inhibitory E2F7 in HEKs and SCC25 cells. In the SCC25 cells, there was more than twice as much E2F1 as E2F7 bound to the SPHK1 promoter (Fig. 1I), but in HEKs, there was more bound E2F7 than E2F1. This contrasts with the observation that E2F7 protein was about 2.5-fold more abundant than E2F1 in the SCC25 cells (Fig. 1, J and K). These data indicate that in SCC25 cells, E2F1 is preferentially bound to the SPHK1 promoter despite the higher total cellular E2F7 expression. Because previous studies showed that other members of the E2F family, such as E2F4 and E2F5, are subject to an XPO1-dependent nuclear export (2729), we examined the subcellular localization of E2F1 and E2F7 in SCC25 cells and HEKs to see whether this could explain the observed discrepancy between promoter binding and total cellular E2F7. Immunofluorescent (IF) analysis of the E2F1 protein revealed strong nuclear staining in HEKs and SCC25 cells. In contrast, we found that E2F7 displayed strong cytoplasmic staining and weak nuclear staining in SCC25 cells, whereas in HEKs, we detected a strong nuclear staining of E2F7 (Fig. 1L). These data indicate that the reduced nuclear localization of E2F7 may cause derepression of SPHK1 promoter activity and expression in SCC25 cells.

E2F7 is frequently mislocalized in HNSCC lesions and causes doxorubicin resistance

To extend our observation on the mislocalization of E2F7 in doxorubicin-resistant SCC cells, we examined the subcellular localization of E2F1 and E2F7 in five different SCC cell lines (KJDSV40, FaDu, Cal27, SCC25, and Detroit562). IF analysis showed that E2F1 was predominantly nuclear in all of these cell types (Fig. 2A). In contrast, we found that E2F7 was predominantly nuclear only in the KJDSV40 cells, whereas all the remaining cell lines displayed prominent cytoplasmic staining and variable to weak nuclear staining of E2F7 (Fig. 2A). Moreover, we examined the localization of other XPO1 cargo such as p53, survivin, and topoisomerase IIa proteins, which have been previously reported to be mislocalized in cancer (3035). However, we found no evidence of their mislocalization in our SCC cell lines and HEKs (fig. S3). Thus, the mislocalization defect was selective for E2F7. Given that SPHK1 expression is directly controlled by E2F1 and E2F7, we determined whether there was a relationship between the relative nuclear expression of E2F1 and E2F7 and SPHK1 expression and doxorubicin sensitivity. First, we noted that total cellular protein expression for E2F1, E2F7, and SPHK1 increased proportionately with increasing doxorubicin resistance (Fig. 2, B and C versus Fig. 1, F to H). However, when we quantitated the nuclear content of E2F7 (E2F7nuc) and expressed it as a ratio of E2F1 present in the nucleus (E2F7nuc/E2F1), we discovered an association with both SPHK1 expression and doxorubicin sensitivity (Fig. 2D). These data are consistent with our ChIP and IF data (Fig. 1) and show that the extent of E2F7 mislocalization in SCC cells correlates with the derepression of SPHK1 expression and increasing doxorubicin resistance.

Fig. 2 Subcellular mislocalization of E2F7 is a common defect in HNSCC lesions and accompanies doxorubicin resistance.

(A) Subcellular localization of E2F7 and E2F1 was detected by immunofluorescence in KJD, FaDu, Cal27, SCC25, and Detroit cell lines. DAPI-counterstained nuclei are in blue, phalloidin-counterstained actin filaments in red, and the merge column displaying E2F7 or E2F1 are in green. Images are representative of three biological replicates. (B and C) Representative Western blot (B) and quantitative analysis (C) of total protein extracts from KJD, FaDu, Cal27, SCC25, and Detroit cell lines. Membranes were probed for E2F1, E2F7, and SPHK1. β-actin was used as loading control. Quantitative data represent means ± SD of triplicate determinations of three biological replicates. Expression normalized to that of β-actin. (D) Nuclear and cytoplasmic fractions from KJD, FaDu, CAL27, SCC25, and Detroit cells were analyzed for total SPHK1 and nuclear E2F7 and E2F1 expression. Quantitative data for E2F7nuc/E2F1nuc represented as means ± SEM of triplicate determinations of two biological replicates. The EC50 values for KJD, FaDu, Cal27, SCC25, and Detroit cells treated for 48 hours with increasing concentration of doxorubicin (0 to 3 μM) were calculated using data from triplicate determinations of three biological replicates. (E) Normal epithelia and HNSCCs from TMAs were stained for E2F1 and E2F7. Representative expression patterns of E2F7 were classified as nuclear (N) if the staining was detected only in the nucleus, nuclear/cytoplasmic (N/C) if the staining was found in both the cytoplasm and nucleus, or cytoplasmic if the staining was predominantly localized to the cytoplasm. All analysis was carried out by a qualified histopathologist (S.B.) in a blinded manner. (F) For quantitative analysis, we pooled data from samples with cytoplasmic or nuclear/cytoplasmic staining and referred to these as N/C. The number of normal epithelium and squamous cell carcinomas TMA cores with a N or N/C E2F7 expression pattern was quantified; results are shown as percentages. A Fisher’s exact test was used to compare N to N/C ratios in tissue samples. *P < 0.05. (G) The number of metastatic regional lymph nodes in tumor samples is plotted (x axis) against the percentage of samples that displayed nuclear E2F7 expression (y axis).

Next, we determined whether there was evidence for E2F7 mislocalization in patient SCCs. Immunohistochemical (IHC) analysis showed that E2F7 was mislocalized in 80% of cutaneous or HNSCC patient tumors (P < 0.001) and confirmed that the localization of E2F7 was predominantly nuclear in normal epidermal and mucosal keratinocytes (Fig. 2, E and F). The major shift in subcellular localization of E2F7 occurred in the transition from normal tissue to early cancer, characterized as tumors with no nodal involvement. However, there was also an association between increasing cytoplasmic localization and disease progression in SCCs, as characterized by increasing nodal involvement (Fig. 2G). Finally, analysis of additional cancer TMAs showed that E2F7 was significantly mislocalized in 82% of colorectal cancers, 73% of prostate cancers, and 70% of breast cancers compared to normal tissue controls (P < 0.05; fig. S4). Thus, E2F7 mislocalization is a common defect in human cancers, where it selectively disrupts the E2F1/E2F7 transcriptional balance.

E2F7 is an XPO1 cargo protein

Our finding that E2F7 is mislocalized in SCC suggests that E2F7 may be subject to nucleocytoplasmic shuttling. E2Fs 4 and 5 are known to be exported from the nucleus via XPO1 (2729). Moreover, XPO1 is overexpressed in a number of tumor types, including HNSCC (36, 37). However, there are no reports of nucleocytoplasmic shuttling of E2F7 (38), and no E2F has been shown to be mislocalized in human tumors before. Thus, we examined whether the mislocalization of E2F7 in SCC was due to XPO1-dependent nuclear export of E2F7. We treated SCC25 cells with an XPO1 inhibitor, selinexor (KPT-330), for 4 or 8 hours and examined the subcellular distribution of E2F7 by Western blotting and immunofluorescence (Fig. 3, A to C). This experiment showed that the XPO1 inhibitor induced nuclear accumulation of E2F7 in SCC25 cells and significantly (P < 0.05) reduced SPHK1 expression (Fig. 3, A to C). Similarly, transfection of an XPO1 siRNA caused a significant (P < 0.05) redistribution of E2F7 to the nucleus in SCC25 cells (Fig. 3, D to F). Moreover, XPO1 siRNA reduced SPHK1 protein expression to undetectable levels (Fig. 3, D and E). Similar results were obtained using doxorubicin-resistant Detroit cells (fig. S5). These data show that the mislocalization of E2F7 in drug-resistant SCC cells is reversible with a pharmacological inhibitor of XPO1. Thus, we examined whether combining doxorubicin with an XPO1 inhibitor would also reverse doxorubicin resistance. Doxorubicin-induced cytotoxicity was significantly enhanced in SCC25 cells (EC50 = 1.9 ± 0.2 μM versus 0.4 ± 0.04 μM; P < 0.001) when combined with selinexor (Fig. 3, G and H). We also observed a significant enhancement of EC50 values in Detroit (1.7 ± 0.3 μM versus 0.1 ± 0.02 μM; P < 0.001; Fig. 3I), Cal27 (0.5 ± 0.02 μM versus 0.22 ± 0.02 μM; P < 0.001; Fig. 3J), and FaDu cells (0.5 ± 0.02 μM versus 0.13 ± 0.01 μM; P < 0.001; Fig. 3K), all of which also displayed a mislocalization defect (Fig. 2A). These functional data are further supported by our analysis of the E2F7 sequence using the LocNES tool for predicting nuclear export signals [NESs; (38)]. This analysis showed that E2F7 had a strong nuclear export sequence located at amino acid 1 to 25. Finally, treatment of SCC25 cells with selinexor enhanced doxorubicin sensitivity, whereas simultaneous knockdown of E2F7 significantly (P <0.01) decreased the sensitization (fig. S6). This experiment shows that mislocalization of E2F7 drives anthracycline resistance. In contrast, selinexor was unable to enhance the cytotoxic action of paclitaxel in the SCC25 cells (fig. S7), indicating that E2F7-dependent drug resistance is not generalized to all anticancer drugs.

Fig. 3 E2F7 is an XPO1 cargo protein.

(A to C) Representative Western blot (A), quantitative analysis (B), and immunofluorescence (C) of nuclear and cytoplasmic (Cyto) expression of E2F7 (A and C) and total expression of SPHK1 (A and B) in SCC25 cells treated with DMSO (1 μl/ml) for 8 hours (A) or 1 μM selinexor for 4 or 8 hours. For immunofluorescence, cells were treated with vehicle or 1 μM selinexor for 24 hours (C). (D to F) Representative Western blot (D), quantitative analysis (E), and immunofluorescence (F) of nuclear and cytoplasmic expression of E2F7 (D and F) and total expression of SPHK1 in SCC25 cells (D and E) treated with DMSO (1 μl/ml) for 32 hours, 25 nM of β-galactosidase control siRNA for 32 hours, or 25 nM XPO1-targeting siRNA for 24 or 32 hours. For Western blot analysis of nuclear and cytoplasmic expression, membranes were probed for E2F7, SPHK1, XPO1, ASH2L, AKT, and actin. ASH2L and AKT were used for normalization of subcellular fractions with actin as a loading control. Data presented as means ± SEM of triplicate determinations of at least two biological replicates. Changes in subcellular location of E2F7 after treatment with 1 μM selinexor (C) or 25 nM XPO1-targeting siRNA (F) were confirmed by immunofluorescence. (G) Western blot analysis of vehicle and 1 μM selinexor-treated SCC25 cells shows expression of full length and cleaved caspase-3. Actin antibody was used for normalization. (H to K) Cytotoxicity assay of vehicle and 1 μM selinexor-treated SCC25 cells (H), Detroit (I), Cal27 (J), or FaDu (K) cells exposed to increasing concentrations of doxorubicin (Dox; 0 to 3 μM) for 48 hours. Data presented as means ± SEM of triplicate determinations from three biological replicates. (B and E) An unpaired t test was used to compare nuclear E2F7, cytoplasmic E2F7, or total SPHK1 expression between vehicle control and the treatment groups (selinexor, β-gal siRNA, or XPO1 siRNA); *P < 0.05 and **P < 0.01. (H to J) An unpaired t test was used to compare the EC50 values for doxorubicin in the various SCC cell lines in the presence or absence of 1 μM selinexor. **P < 0.01 and ***P < 0.001.

E2F7 mislocalization is an actionable pathology in HNSCC

To test the in vivo efficacy of a doxorubicin + selinexor combination, we generated xenotransplant tumors using SCC cells in which E2F7 was mislocalized to the cytoplasm (SCC25 or Detroit cells). Consistent with our in vitro findings, the SCC25 xenotransplant tumors treated with selinexor + doxorubicin were significantly smaller (tumor volume) at day 21 after treatment compared with vehicle or single-agent treatment groups (P < 0.05; Fig. 4A). Moreover, the doxorubicin + selinexor combination significantly increased the expression of the apoptosis marker cleaved caspase-3 and significantly reduced the expression of the proliferation marker Ki67 (P < 0.05; Fig 4, B and C). Similarly, selinexor relocalized E2F7 to the nucleus of Detroit cells and was significantly more cytotoxic than vehicle or treatment with selinexor or doxorubicin alone, as shown by tumor volumes and cleaved caspase-3 and Ki67 staining (P < 0.05; fig. S8A). Notably, IHC analysis showed that selinexor caused nuclear accumulation of E2F7 in the SCC25 tumors (Fig. 4D), thus confirming the pharmacological activity of selinexor.

Fig. 4 E2F7 mislocalization is an actionable pathology in HNSCC.

(A to D) Xenotransplant model of SCC25 and (E and F) PDXs from two tumor donors were generated, and mice were treated for 14 days with (i) vehicle (0.6% plasdone PVP K-29/32 and 0.6% Poloxamer pluronic F-68), (ii) doxorubicin (0.5 mg/kg), (iii) selinexor (15 mg/kg), or (iv) selinexor (15 mg/kg) + doxorubicin (0.5 mg/kg). Mice were sacrificed 5 days after cessation of treatment or at attainment of an ethical threshold. (A) Individual values of the tumor growth curve are presented as means ± SEM (n = 4). Resected tumors at completion of the study are shown in the right-hand panel. (B) IHC detection of the expression of apoptosis (cleaved caspase-3) and proliferation (Ki67) markers in resected tumors. (C) Quantitative analysis for the expression of apoptosis (cleaved caspase-3) and proliferation (Ki67) markers in resected tumors. Quantitative data represent percentages of positive cells and are presented as means ± SEM of two to four tumors. (D) Images show hematoxylin and eosin (H&E) or E2F7 staining for the human-specific marker CK5/6. Representative images (E) and quantitative analysis (F) of resected PDX tumors showing the expression of apoptosis (cleaved caspase-3) and proliferation (Ki67) markers. Quantitative analysis represents percentages of positive cells, presented as means ± SEM of quadruplicate determinations from at least two tumors per condition. (A) An unpaired t test was used to compare tumor volumes in the selinexor + doxorubicin–treated mice to the tumor volumes of untreated mice or mice treated with each agent alone. **P < 0.01 and ***P < 0.001. (C and F) An unpaired t test was used to compare values of treatment groups to their respective vehicle-treated group. *P < 0.05, **P < 0.01, and ***P < 0.001.

To validate our observations from cell line xenotransplants, we repeated the drug treatments in two patient-derived xenotransplant (PDX) samples of oral SCC, which displayed cytoplasmic localization of E2F7 (referred to as PDXc) and one PDX in which E2F7 was localized to the nucleus (referred to as PDXn). After passage of the original tumor biopsy in mice, we generated sufficient second-generation PDX tumor-bearing mice to examine the effect of the selinexor + doxorubicin combination. The PDXc tumors grew at a variable rate, making it difficult to generate meaningful tumor growth rate curves across the treatment groups. Despite this, we found that PDXc tumors displayed significant increases in cleaved caspase-3 and reduced Ki67 staining in all treatment groups compared to the control group (P < 0.05; Fig 4, E and F). However, treatment with doxorubicin + selinexor significantly increased cleaved caspase-3 staining and reduced Ki67 staining compared to the individual agents (P < 0.001; Fig. 4F). Combined, our data demonstrate that selinexor is able to reinstate the nuclear localization of E2F7, resulting in improved sensitivity to the cytotoxic effects of doxorubicin in HNSCC.

Finally, we generated a PDX tumor from a primary tumor in which E2F7 retained nuclear localization (PDXn; fig. S8B). This tumor implanted and grew in a synchronous manner across the second-generation mice. Analysis of the tumor growth curves revealed that this tumor was sensitive to doxorubicin alone and failed to show significant enhancement of sensitivity in response to selinexor or the combination (fig. S8B). These data support our proposition that nuclear expression of E2F7 is required to induce doxorubicin sensitivity. Combined, these studies indicate that the E2F7 mislocalization defect could be used as a marker to stratify patients for inclusion in future clinical trials of a selinexor + doxorubicin combination.

DISCUSSION

About 40 to 50% of patients with advanced HNSCCs will die of their disease due to acquired or inherent therapy resistance. Unfortunately, the prognosis for these patients has remained unchanged for over four decades due to the lack of therapies to bypass or reverse drug resistance (3, 4). Hence, there is a large unmet clinical need to identify actionable targets within drug resistance pathways that can be exploited to overcome therapy resistance. We provide evidence that resistance to anthracyclines is driven by E2F in an S1P-dependent manner in SCC. Specifically, we show that anthracycline resistance emerges due to an imbalance between the activating E2F1 and the inhibitory E2F7 transcription factors. This imbalance is due to the pathological activation of export of E2F7 from the nucleus via the XPO1 pathway. Overall, our study demonstrates (i) that E2F7 is subject to XPO1-dependent nuclear export; (ii) that E2F7 is selectively mislocalized in greater than 80% of human SCC; (iii) that mislocalization of E2F7 in HNSCC causes derepression of SPHK1 and its catalytic product, S1P, which, in turn, drives anthracycline resistance; and (iv) that anthracycline resistance is actionable and can be reversed with an inhibitor of XPO1 in xenotransplant models of HNSCC.

E2F1 and E2F7 are mutually antagonistic, yet both are often overexpressed in cancers such as SCC (9). Despite their mutually antagonistic activity, up-regulation of E2F-dependent gene targets is often observed in cancer, suggesting an imbalance between the activating and inhibitory E2Fs (26). Our study provides an explanation as to how simultaneous elevation of the mutually antagonistic E2F1 and E2F7 results in a transcriptional bias favoring overexpression of E2F-dependent genes and E2F-dependent pathways in SCC. Specifically, we have shown that the export of E2F7 from the nucleus results in derepression of E2F target genes such as SPHK1 (9). Moreover, it provides a likely explanation for the overexpression of other E2F target genes such as RACGAP1, E2F1, and E2F7 in SCC (9, 10). E2F7 is a direct transcriptional target of E2F1, and E2F1 is a direct transcriptional target of itself and E2F7. In this way, E2F1 and E2F7 expression self-regulates. This balance is disrupted when E2F7 is selectively exported from the nucleus, resulting in derepression of E2F1, which in turn induces E2F1 and E2F7 expression. This pathology alone could explain many of the E2F-associated effects observed in SCC, such as hyperproliferation, drug resistance, and aberrant differentiation. Moreover, we found evidence that this pathology exists in other cancer types such as prostate, colorectal, and breast cancer as well. Thus, strategies that relocate E2F7 to the nucleus could potentially restore an E2F1/7 balance and normalize E2F-dependent functions in SCC-derived keratinocytes and possibly other tumor types.

The present study highlights an E2F-dependent S1P axis responsible for anthracycline resistance in SCC. The activation of this drug resistance axis is a direct result of the mislocalization of E2F7 and the consequent derepression of SPHK1 expression. This is most easily appreciated from our finding that selinexor failed to induce anthracycline sensitivity in the presence of E2F7 knockdown, indicating that anthracycline resistance is due to loss of nuclear E2F7. Further support comes from our observation that E2F1 (activator) and E2F7 (inhibitor) compete for binding to the SPHK1 promoter. Thus, the mislocalization of E2F7 results in an E2F1-dependent induction of SPHK1 expression. This is supported by ChIP analysis of E2F1 and E2F7 binding to the SPHK1 promoter in normal human keratinocytes and SCC cells. Moreover, knockdown of E2F1 reduced SPHK1 expression and enhanced doxorubicin sensitivity, whereas knockdown of E2F7 derepressed SPHK1 expression and reduced doxorubicin sensitivity. Finally, although E2F1 and E2F7 were both overexpressed in SCC cell lines, the extent of SPHK1 promoter binding, SPHK1 expression, and doxorubicin sensitivity correlated with the relative amount of E2F1 to E2F7 within the nucleus but not the total cellular expression. These data show the critical dependence of SPHK1 expression and doxorubicin sensitivity on the opposing actions of E2F1 and E2F7. Because dysregulation of the Rb/E2F axis is a common defect in SCC (9, 26), resulting in E2F activation, this is likely to explain the overexpression of SPHK1 and doxorubicin resistance observed in HNSCC. This would also suggest that the mislocalization is a consequence of neoplastic transformation rather than a driver of transformation. Finally, the observation that E2F7 knockdown can induce SPHK1 expression and doxorubicin resistance suggests that these are isoform-specific functions of E2F7. This extends our understanding of the complexity of the E2F family because earlier studies with murine skin painting SCC models determined that E2F7 and E2F8 shared nonredundant properties (9).

We have established a direct link between the mislocalization of E2F7 and SPHK1/S1P-induced anthracycline resistance. The mechanism by which SPHK1/S1P induces anthracycline resistance cannot be attributed to a global antiapoptotic mechanism such as activation of B cell lymphoma 2 (BCL2) homology domain 2/3 proteins (for example, BCL2) or phosphatidylinositol 3-kinase/AKT activation. Supporting this is the observation that a combination of SPHK1 inhibition (genetic or pharmacologic) is able to reverse anthracycline resistance but is unable to alter responses to other cytotoxic agents such as cisplatin (9, 10). Similarly, the use of an XPO1-selective inhibitor can restore E2F7 nuclear localization and reverse resistance to doxorubicin but not to paclitaxel. Thus, the mechanism by which E2F7 mislocalization induces anthracycline resistance is context-specific.

Previous studies have shown that E2F activity is linked to the sensing and repair of DNA damage in the context of murine cutaneous SCC (26). Doxorubicin induces double-strand DNA breaks, and thus, the E2F/SPHK1/S1P axis may work by modulation of responses to doxorubicin-induced DNA damage. Regardless of the mechanism, the link between the mislocalization of E2F7 and SPHK1/S1P-induced anthracycline resistance provides a translational opportunity because the E2F/SPHK1/S1P axis is actionable via pharmacological inhibitors of SPHK1 (9) or XPO1 in combination with doxorubicin. Lending support to the potential clinical value of targeting E2F/SPHK1/S1P pathway is the observation that most of cutaneous SCCs and HNSCCs have high expression of E2F1, E2F7, SPHK1, and another E2F target RACGAP1 (9, 10). The high expression of these E2F-dependent targets accompanies a poor outcome (9, 10) and suggests that the reinstatement of a “normal” nuclear E2F balance may reverse many of these poor prognostic features of SCC.

Here, we show that E2F7 mislocalization is a common pathology in multiple cancer types such as HNSCC, cutaneous SCC, prostate, colorectal, and breast cancer. Central to this, we provide evidence that E2F7 is a cargo for XPO1-dependent nuclear export. This is supported by data showing that (i) E2F7 contains a high-confidence NES between amino acid 1 and 25 (38) and (ii) E2F7 can be relocalized to the nucleus after treatment with XPO1 siRNA or selinexor. The identification of this pathology has clinical and therapeutic implications for the management of HNSCC. Defects in XPO1 activity have been reported in other cancers (39). For example, mutation of the NES in cargo proteins causes defects in XPO1-dependent nuclear export of BRCA2 in breast cancer (39). This is not the case for the mislocalization of E2F7 because there is no evidence in public databases for mutations in E2F7 NES in HNSCC or other cancer types (38). Similarly, although SCCs overexpress XPO1, it is unlikely that this is the reason for the defect in HNSCC. For instance, topoisomerase IIa p53, survivin, and E2F1 are established cargo of XPO1, yet we found no evidence for their exclusion from the nucleus in our SCC cells. In contrast, E2F7 displayed a mislocalization phenotype in greater than 80% of human SCC. Thus, E2F7 mislocalization is a common context-specific pathology in SCC and results in SPHK1 induction and anthracycline resistance.

A limitation of the present study is that the molecular basis for the mislocalization defect remains unknown. The observation that other XPO1 cargo such as E2F1, topoisomerase IIa, and survivin are not affected would suggest that the defect is not attributable to alterations/mutations in the XPO1 protein itself. Rather, the mislocalization defect is likely due to a pathology-driven posttranslational modification (marking) of the E2F7 protein (E2F7 is not mutated in SCC) or an interacting partner protein. The concept of “marking” cargo for export is not unprecedented because selective nuclear export occurs in differentiating keratinocytes. For example, E2F5 nuclear export is selectively reduced during squamous differentiation, and E2Fs 4 and 5 display differential subcellular localization in keratinocytes despite both being XPO1 cargo (2729). Thus, selective marking of nuclear proteins for export is observed in keratinocytes. Extending this, it is likely that XPO1 inhibitors such as selinexor may alter the export of multiple cargo proteins because they globally inhibit XPO1. Although this could be seen as a limitation of the drug, it is clear from the present study and the clinical evidence (details below) that it is able to relocate a select suite of effectors, such as E2F7, needed to induce an anticancer response. The present study has shown that the mislocalization of E2F7 alone can account for doxorubicin resistance.

Inhibition of XPO1 activity has been used to kill various cancer cell types in vitro and in vivo (37, 4043). There is considerable enthusiasm for this class of agents, with multiple clinical trials of selinexor underway. Data from earlier trials show selinexor to be tolerated at doses sufficient to show evidence of XPO1 inhibition [35 mg/m2; (44)]. Moreover, early results indicate that blood cancers may be more sensitive to selinexor than solid tumors (44, 45). The most recent trial of selinexor in relapsed acute lymphoblastic leukemia resulted in 47% of patients achieving a complete response (46). Our study suggests that reversal of the E2F7 nuclear export defect using selinexor in combination with anthracyclines may provide a therapeutic opportunity to treat SCC. The reversal of drug resistance appears to be restricted to anthracyclines because we saw no evidence for improved sensitivity when selinexor was combined with paclitaxel. A recent report in myeloma cells has shown that selinexor is able to reinstate nuclear localization of topoisomerase IIa in multiple myeloma cells and make them sensitive to topoisomerase inhibition (42). Although we observed no defect in topoisomerase IIa localization in the SCC cells, it is clear that E2F1-dependent activation of the SPHK1/S1P axis acts to suppress the cytotoxic action of anthracyclines in SCC cells. Our data support the initiation of a human clinical trial to test the efficacy of an anthracycline plus selinexor in relapsed SCC patients with evidence of E2F7 mislocalization.

MATERIALS AND METHODS

Study design

The overall aims of this study were to (i) establish the mechanism by which E2F controls doxorubicin sensitivity in SCC, (ii) establish the extent to which this mechanism is evident in human tumors, and (iii) identify strategies to reverse doxorubicin resistance in SCC. To address these aims, we examined the relationship between the activating E2F1 and repressive E2F7 with regard to the transcription of SPHK1 and anthracycline resistance. Because E2F1 and E2F7 are mutually antagonistic, we examined the possibility that anthracycline resistance is due to derepression of SPHK1 caused by the mislocalization of E2F7 in SCC and other tumor types. This involved exploration of a suite of human SCC cell lines and human TMAs for SCC, colon, breast, and prostate cancer and their corresponding normal epithelia. Next, we examined whether E2F7 mislocalization is attributable to XPO1-mediated nuclear export using specific pharmacological inhibitors and siRNAs. Finally, we tested the clinical potential of XPO1 inhibitors to relocate E2F7 to the nucleus and reverse anthracycline resistance in xenotransplant models of established human SCC cell lines and PDX material.

In all experiments, sample size was determined by previous experience of the statistical variance encountered, and hence, our design was driven by an appreciation of the power required to determine significance. In all animal experiments, mice were randomly assigned to treatment groups, and minimum numbers of mice were used. Analysis of TMA images was performed by a qualified histopathologist (S.B.) in a blinded manner. Analysis of IHC results was performed in a blinded manner to ensure no bias in reporting. The choice of statistics to be used was based on sample size and determination of sample/population equivalence between groups.

Cell culture

HEKs were isolated and cultured from neonatal foreskins, as described previously (9). HEKs were grown in low-calcium serum-free keratinocyte medium (Life Technologies). Isolated HEKs were maintained as proliferative cultures and were serially cultured for up to four passages. The SCC25 and Detroit562 cell lines were purchased from American Type Culture Collection (Cryosite). KJDSV40 cell line was a gift from P. Gallimore (Birmingham, UK), and the Cal27 and FaDu cell lines were a gift from E. Musgrove (Garvan Institute, Sydney, Australia). All cell lines were authenticated by short tandem repeat genotyping. The SCC cell lines were maintained in 1:1 Dulbecco’s modified Eagle’s medium/Ham’s F12 nutrient mix (pH 7.1) medium (Life Technologies) as previously described (9).

IHC and TMAs

IHC was performed on formaldehyde-fixed, paraffin-embedded slides, as described previously (19). Briefly, deparaffinized slides were rehydrated and incubated with a tris-EDTA (pH 9.0) (10 mM tris base, 1 mM EDTA, and 0.05 % Tween 20) antigen retrieval solution in a decloaking chamber (Biocare Medical). Nonspecific antibody binding was blocked with 10% fetal bovine serum (Bovogen Biologicals) for 1 hour, followed by overnight incubation with anti-E2F7 (1:50; Abcam, ab56022), anti-E2F1 (1:100; Santa Cruz Biotechnology, KH95), anti-Ki67 (1:1000; Abcam, ab15580), or anti-cytokeratin 5/6 (1:100; Novus Biologicals, T16-K) primary antibodies. To visualize antigens, slides were washed and incubated for 1 hour with horseradish peroxidase (HRP)–conjugated anti-rabbit (GE healthcare, NA934V) or anti-mouse (Life Technologies, 626520) IgG secondary antibody conjugated with HRP (GE healthcare, NA934V) and Cardassian DAB chromogen (Biocare Medical). Normal rabbit (Dako, X0936) or normal mouse (Santa Cruz Biotechnology, SCZSC-2025) IgG was used as negative control. Expression of cleaved caspase-3 protein was detected using the SignalStain Apoptosis IHC Detection kit (Cell Signaling Technology, 12692s). The TMAs with reference numbers SK802a, HN483, HNT1021, and TMA2401a were purchased from US Biomax Inc. An additional TMA was constructed by M. Dzienis and A. C. Vargas at the Medical Oncology Department of the Princess Alexandra Hospital, Australia, as described (9). Staining localization and intensity was evaluated by a pathologist (S.B.) using a modified quick score method described previously (47). The prostate, breast, and colorectal tissue and carcinoma cores from the TMA with reference number TMA2401a were processed using the Ventana platform, according to the manufacturer’s instructions. All images were processed using the “auto contrast” tool from Adobe Photoshop CC 2017.

siRNA delivery and transfections

About 2 × 105 SCC cells were plated into six-well plates and transfected with validated siRNA sequences targeting β-galactosidase (Sigma-Aldrich), E2F7 (9), E2F1 (Sigma-Aldrich), or XPO1/CRM1 (Thermo Fisher Scientific, s14937) using Lipofectamine 2000 Transfection Reagent (Invitrogen), according to the manufacturer’s instructions. SiRNA sequences are reported in table S1.

Immunofluorescence

About 3 × 104 normal HEKs or SCC cells were plated onto 12-mm coverslips (ProSciTech). The next day, cells were treated with (i) 1:1000 DMSO (Sigma-Aldrich), (ii) Lipofectamine 2000 (5 μl/ml), (iii) 1 μM selinexor (Karyopharm Therapeutics), (iv) 25 nM NC control siRNA, or (v) 25 nM XPO1-targeting siRNA (Thermo Fisher Scientific, s14937). Coverslips were then fixed with 4% paraformaldehyde (Histopot, Australian Biostain) for 15 min and permeabilized with 0.1% Triton X-100 (LabChem) for an additional 20 min. The cells were blocked in 2% bovine serum albumin (Sigma-Aldrich) solution for 30 min, followed by incubation with anti-E2F7 (1:50), anti-E2F1 (1:100), anti-topoisomerase IIa (1:100; Abcam, ab52934), anti-survivin (1:100; Cell Signaling Technology, 71G4B7), or anti-P53 (1:100; Santa Cruz Biotechnology, SC-6243) primary antibodies. Secondary anti-rabbit (1:100; Life Technologies, A11070) or anti-mouse (1:100; Invitrogen, A-11001) antibodies conjugated with Alexa Fluor 488 were used for protein detection. Nuclei and actin filaments were counterstained with DAPI (Cell Signaling Technology, 4083s) and phalloidin (Santa Cruz Biotechnology, SCZSC-363795), respectively. The solutions described for fixation, permeabilization, and blocking were used at 4°C. Normal rabbit or mouse IgG was used as negative controls. Immunostaining was visualized using a Zeiss LSM 510 Meta confocal microscope.

Protein isolation and immunoblotting

Cell lysis and separation of the nuclear and cytoplasmic fractions were done using the NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Fisher Scientific, 78833), according to the manufacturer’s instructions. Total protein was extracted using a radioimmunoprecipitation assay buffer [150 mM NaCl, 20 mM tris, 1% Triton X-100, 0.1 % SDS, 0.5 % sodium deoxycholate (pH 8.0)]. Total or fractionated subcellular proteins (20 μg) were then resolved in a 10% SDS–polyacrylamide gel electrophoresis gel and transferred onto a polyvinylidene fluoride membrane (Immobilon-FL, Millipore). Membranes were exposed to one of the following primary antibodies for at least 12 hours: anti-E2F7 (1:500), anti-E2F1 (1:1000), anti-AKT (1:2000; Cell Signaling Technology, 9272S), anti-XPO1 (1:1000; Sigma-Aldrich, 37784), anti-ASH2L (1:2000; Cell Signaling Technology, D93F6), anti–caspase-3 (1:1000; Cell Signaling Technology, 9662), anti-cleaved caspase-3 (1:1000; Cell Signaling Technology, 9661S), anti-actin (1:4000; Santa Cruz Biotechnology, sc-44778), and anti-SPHK1 (1:1000; Sigma-Aldrich, HPA022829). To visualize the results, the membranes were incubated for 1 hour with anti-rabbit or anti-mouse IgG secondary antibodies conjugated with HRP. The reactions were developed using the Super Signal West Pico ECL reagent (Pierce, Thermo Fisher Scientific) and a FusionSL detection system (Vilber Lourmat). Quantitative analysis of protein concentration was performed using ImageJ (National Institutes of Health).

Quantitative reverse transcription polymerase chain reaction

Total RNA was isolated with TRIsure reagent (Bioline, BIO-38032), and complementary DNA (cDNA) was prepared using the Tetro cDNA Synthesis Kit (Bioline, BIO-65042), according to the manufacturer’s instructions. Quantitative reverse transcription polymerase chain reaction (PCR) was performed, as described previously (21), using the following primer sequences: SPHK1, AAGACCTCCTGACCAACTGC (forward) and GGCTGAGCACAGAGAAGAGG (reverse); E2F1, TCCAAGAATCATATCCAGTGGCT (forward) and GCTGGAATGGTGTCAGCACAGCG (reverse); E2F7, GTCAGCCCTCACTAAACCTAAG (forward) and TGCGTTGGATGCTCTTGG (reverse); TBP, TCAAACCCAGAATTGTTCTCCTTAT (forward) and CCTGAATCCCTTTAGAATAGGGTAGA (reverse).

Chromatin immunoprecipitation

DNA from 4 × 106 cells was collected. The simple ChIP Enzymatic IP kit (Cell Signaling Technology) was used in accordance with the manufacturer’s instructions. Chromatin was incubated overnight at 4°C with normal rabbit IgG (Cell Signaling Technology), anti-E2F1 (1 μg per IP; Santa Cruz Biotechnology, sc-193), or anti-E2F7 (1 μg, intraperitoneally; Abcam, ab56022) antibodies. We performed quantitative PCR of the SPHK1 promoter binding region and calculated relative enrichment, as described in (9). The following SPHK1 promoter primers were used: GGGACCCTTGGTTTCACCTC-3′ (forward) and GAATTTCGGGTGGGCTAGGG-3′ (reverse).

Viability assays

Cell viability, after treatment with siRNAs or drugs, was analyzed using the Cell Titer 96 Aqueous One Solution Cell (Promega), according to the manufacturer’s instructions. Briefly, 7.5 × 103 SCC cells were plated in triplicate in 96-well plates and allowed to adhere for 24 hours before treatment with vehicle (DMSO), 100 nM E2F7-targeting siRNA, or 1 μM selinexor alone or in combination with increasing concentrations of doxorubicin (0 to 3 μM) for 48 hours. Viability was quantified by reading the absorbance at 490 nm in a Multiskan FC Microplate Photometer (Thermo Fisher Scientific). The data were analyzed using GraphPad Prism v5 software.

Generation of a PDX animal model

Human SCC tissue samples were obtained from patients with primary and secondary SCC after surgical biopsy. All samples were obtained with patient consent and approval from our Institutional Ethics Committee. The tumors were then decontaminated [overnight incubation with penicillin, streptomycin, and gentamicin (10 ng/ml) and amphotericin B (200 ng/ml)], coated with Matrigel (Falcon), and implanted into a subcutaneous “pocket” created in the scruff of the neck of a nonobese diabetic/severe combined immunodeficient (NOD/SCID) female mouse. “First-generation” tumors were allowed to grow until they reached 10 mm in diameter and were then passaged into 16 NOD/SCID “second-generation” females. The second-generation tumors were allowed to grow and were used for drug efficacy testing. All the animal studies had approval from our Institutional Bioethics Committee.

In vivo drug efficacy testing

In vivo drug efficacy was determined using our PDX model or cell line xenotransplant models. For the xenotransplant model, female NOD/SCID mice were injected subcutaneously with 1.5 × 106 SCC25, Detroit562, or FaDu cells, and tumors were allowed to grow. Once the xenotransplant or PDX tumor reached 4 mm in diameter, they were randomly assigned to four groups, and mice were treated twice per week for 3 weeks with (i) vehicle (0.6% plasdone PVP K-29/32 and 0.6% Poloxamer pluronic F-68), (ii) doxorubicin (0.5 mg/kg) (Sigma-Aldrich), (iii) selinexor (15 mg/kg), or (iv) selinexor (15 mg/kg) + doxorubicin (0.5 mg/kg). Mice were monitored twice per week for changes in weight and tumor size. Animals were sacrificed at the end of the 3-week period or if the tumors reached 10 mm in diameter. Student’s t test with 95% confidence interval was used to calculate statistical significance (GraphPad Prism v5 software).

Study approvals

The work presented in this manuscript is covered by approvals from the Princess Alexandra Hospital Human Ethics Committee (HREC/14/QPAH/150) and the University of Queensland Animal Ethics Committee (UQDI/357/17).

Statistical analysis

After F test evaluation to determine similarity in sample distribution and variance, data were analyzed using unpaired Student’s t test. Analysis of statistical differences between nuclear or nuclear/cytoplasmic staining of normal or cancerous epithelia was performed with a Fisher’s exact test. In all instances, P ≤ 0.05 was considered significant.

SUPPLEMENTARY MATERIALS

www.sciencetranslationalmedicine.org/cgi/content/full/10/447/eaar7223/DC1

Fig. S1. SiRNA knockdown of E2F7 and E2F1 is demonstrated in SCC cell lines.

Fig. S2. E2F1 and E2F7 control SPHK1 mRNA expression.

Fig. S3. Subcellular localization of survivin, topoisomerase IIa, and p53 is nuclear in SCC cell lines.

Fig. S4. Subcellular mislocalization of E2F7 is a common defect in prostate, colon, and breast carcinomas.

Fig. S5. E2F7 is an XPO1 cargo protein.

Fig. S6. Mislocalization of E2F7 drives anthracycline resistance.

Fig. S7. Selinexor does not enhance the cytotoxic effect of paclitaxel in SCC25 cells.

Fig. S8. E2F7 mislocalization is an actionable pathology in HNSCC.

Table S1. SiRNA sequences used in this study.

Reference (48)

REFERENCES AND NOTES

Acknowledgments: We acknowledge the assistance of F. Simpson in sample collection and Y. M. Chook with the identification of the E2F7 NES. We acknowledge the gift of cell lines from P. Gallimore (Birmingham, UK) and E. Musgrove (Garvan Institute, Sydney, Australia). Finally, we acknowledge all the patients who donated tissue for our study. Funding: N.A.S. is supported by a Senior Research Fellowship awarded by the Cancer Council Queensland. N.S.-P. is supported by an International Postgraduate Research Scholarship and an Australian Postgraduate Award. R.P. is supported by an Australian Postgraduate Award, and O.M.G. is funded by Research Grant awarded by the Wesley Medical Research Institute. This work was supported by a grant from Zarraffas Coffee to N.A.S. and B.P. and a Cyril Gilbert Testimonial Grant awarded by the Gallipoli Medical Research Foundation to B.P. Author contributions: N.S.-P. contributed to experimental work, experimental design, writing, and data analysis and interpretation. R.P. contributed to experimental work on PDX model. L.M.d.L. contributed to all laboratory animal work. T.K. contributed to IHC and data analysis. C.A. contributed to design and interpretation of data. Y.L. contributed to design and interpretation of data. M.H.-R. contributed to in vitro experimental work. S.B. performed all histopathological work. B.P. provided patient samples and contributed to data interpretation. M.J. contributed to work on XPO1 cargo. D.D. contributed to work on XPO1 cargo and data interpretation. O.M.G. co-supervised all work and contributed to in vitro experimental work, experimental design, and data analysis and interpretation. N.A.S. directed all experimental activity and contributed to data interpretation, analysis, and writing of manuscript. Competing interests: T.K., C.A., and Y.L. are employees of the manufacturer of selinexor (Karyopharm). Karyopharm provided no direct funding for the current study, and the work and selinexor were provided on a collaborative basis. M.J. and D.D. are employees of KU Leuven. KU Leuven has a license agreement on XPO1 inhibitors (selinexor). KU Leuven provided no direct funding for the current study, and all work was undertaken on a collaborative basis. All other authors declare that they have no competing interests.
View Abstract

Navigate This Article