Research ArticleInfectious Disease

Two-mAb cocktail protects macaques against the Makona variant of Ebola virus

See allHide authors and affiliations

Science Translational Medicine  09 Mar 2016:
Vol. 8, Issue 329, pp. 329ra33
DOI: 10.1126/scitranslmed.aad9875

One-two punch for Ebola

Antibody cocktails are an appealing therapeutic option for emerging infections such as the recent Ebola virus outbreak in West Africa because of their scalability and specificity. Qiu et al. report that the antibody cocktail used in Ebola virus–infected patients can be further simplified to only two antibodies and that these antibodies can be produced in engineered Chinese hamster ovary cells. This cocktail protected nonhuman primates against the virus responsible for the 2014–2015 outbreak up to 3 days after exposure. Combining these antibodies with those specific for other strains may lead to a broad ebolavirus therapy.

Abstract

The 2014–2015 Ebola virus (EBOV) outbreak in West Africa highlighted the urgent need for specific therapeutic interventions for infected patients. The human-mouse chimeric monoclonal antibody (mAb) cocktail ZMapp, previously shown to be efficacious in EBOV (variant Kikwit) lethally infected nonhuman primates (NHPs) when administration was initiated up to 5 days, was used in some patients during the outbreak. We show that a two-antibody cocktail, MIL77E, is fully protective in NHPs when administered at 50 mg/kg 3 days after challenge with a lethal dose of EBOV variant Makona, the virus responsible for the ongoing 2014–2015 outbreak, whereas a similar formulation of ZMapp protected two of three NHPs. The chimeric MIL77E mAb cocktail is produced in engineered Chinese hamster ovary cells and is based on mAbs c13C6 and c2G4 from ZMapp. The use of only two antibodies in MIL77E opens the door to a pan-ebolavirus cocktail.

INTRODUCTION

Ebola virus (EBOV; species Zaire ebolavirus, family Filoviridae) is responsible for outbreaks of Ebola virus disease (EVD) in Africa. The 2014–2015 West African outbreak is notable for many reasons (1, 2): it is the first outbreak of EBOV to occur outside of Central Africa; it is the first filovirus outbreak to last over 1 year; and it is the first to spread to more than several hundred individuals (more than 27,000 cases including more than 11,000 deaths, as of June 2015). The outbreak was caused by a novel EBOV variant named Makona (3, 4). Because past EBOV outbreaks were localized geographically and often self-limiting, the scale of the 2014–2015 outbreak took the international community by surprise. A number of foreign aid workers, mostly from Europe and North America, were also infected while assisting in Ebola treatment units (5). Many of these workers were repatriated to their home countries and given a number of experimental treatments. One of those treatments was ZMapp, a cocktail of three monoclonal antibodies (mAbs) directed against the EBOV glycoprotein (GP). ZMapp combines the best-performing antibodies from two different cocktails (6): MB-003, containing mAbs 13C6, 6D8, and 13F6 (7); and ZMAb, containing mAbs 1H3, 2G4, and 4G7 (8). The final formulation of ZMapp contains mAbs c13C6, c2G4, and c4G7 and was shown to rescue 100% of lethally infected nonhuman primates (NHPs) even when the treatment began as late as 5 days after exposure, thus capable of reversing advanced EVD (6).

The first humans to receive ZMapp were two American aid workers who had contracted EVD while working in Liberia during the summer of 2014. At the time of treatment under compassionate use guidelines, both patients had signs of advanced EVD including hypovolemia, hypocalcemia, hypokalemia, and hypoalbuminemia, and one patient also had substantial liver injury as a result of the infection (9). The administration of ZMapp coincided with a subsequent decrease in viremia, and both patients survived the infection. ZMapp was subsequently used compassionately with seven other patients, and four survived EVD (10). ZMapp is currently being evaluated in a randomized controlled trial in West Africa (11). Attempts to manufacture ZMapp on a larger scale have been met with challenges due in part to low 4G7 yields in both plant and mammalian expression systems. To attempt to provide more manufacturing capacity for these mAbs, Public Health Agency of Canada (PHAC) and Mapp Biopharmaceutical collaborated with Beijing Mabworks to produce ZMapp-like mAbs in modified Chinese hamster ovary (CHO) cells; this version of the cocktail is called MIL77 and is composed of MIL77-1 (containing the variable regions of c2G4), MIL77-2 (containing the variable regions of c4G7), and MIL77-3 (containing the variable regions of c13C6). The antibodies in MIL77 also had their framework regions modified to be more similar to human framework regions. The CHO cells used for the expression of MIL77 are engineered to prevent fucosylation, similar to the N-glycosylation present in plant-produced ZMapp; the absence of fucose increases the affinity of the mAbs for the Fcγ receptor IIIa (FcγRIIIa) (CD16) (12). Mabworks confirmed that MIL77-2 (based on mAb c4G7) had a much lower expression than MIL77-1 and MIL77-3 in their system. Although initial studies suggested that c2G4 and c4G7 bind separate epitopes (13), a more detailed structural analysis of ZMapp revealed that the two mAbs bind overlapping epitopes on the EBOV GP (14, 15), suggesting that these two treatment components are redundant. Our objectives were to confirm whether the cocktail produced in the modified CHO cells had similar properties and comparable efficacy to the plant-produced ZMapp and to evaluate the impact of removing mAb c4G7 (MIL77-2).

RESULTS

MIL77-1 contains five different amino acids compared with ZMapp c2G4; there were 3 changes for MIL77-2 (compared with ZMapp c4G7); and there were 20 changes for MIL77-3 (compared with ZMapp c13C6). None of the observed changes were in the complementarity-determining regions. The sequences of the variable regions in the antibodies were determined by mass spectrometry (MS) and liquid chromatography–tandem MS (LC-MS/MS) tryptic peptide mapping.

To assess the glycosylation of MIL77, we labeled the N-linked oligosaccharides with 2-aminobenzamide (2-AB) and analyzed them using hydrophilic interaction liquid chromatography (HILIC). In Fig. 1A, less than 1% of the glycans of MIL77 contained fucose, all in the form of G0F. The structures of the oligosaccharides were confirmed to be G0, G1, and G1′ by LC-MS/MS characterization of the enzymatically released N-oligosaccharides with 2-AB tag HILIC separation (table S1).

Fig. 1. Characterization of MIL77.

(A) HILIC analysis of the peptide N-glycosidase (PNGase) F enzymatically released N-glycans with 2-AB fluorescence tag. MAb1, a recombinant humanized immunoglobulin G1 (IgG1) mAb produced with normal CHOK1 cells that has typical N-glycan profile, is used as control. GlcNac, N-acetylglucosamine. (B) Affinity of MIL77 components for human CD16 (FcγRIIIa), determined by enzyme-linked immunosorbent assay (ELISA). OD450, optical density at 450 nm. (C) Time-concentration curves for six animals given MIL77 (150 mg/kg) (1 + 2 + 3).

As displayed in Fig. 1B, we evaluated the affinity of the components of MIL77 for FcγRIIIa (CD16) using ELISA. The median binding concentrations (BC50) were found to be similar for the three antibodies and in the range of 0.08 to 0.09 μg/ml. The results suggest that mAbs do bind to CD16 at physiological concentrations and that CD16-mediated mechanisms would be available to supplement the documented neutralizing activity of the antibodies (14, 16).

To ensure that the antibodies were not altered by the changes in the framework regions, we performed anti–EBOV GP ELISA and anti–EBOV–eGFP (enhanced green fluorescent protein) neutralization assays. The ELISA titration curves were very similar, with BC50 values with overlapping 95% confidence intervals for c2G4/MIL77-1 and c13C6/MIL77-3, whereas c4G7/MIL77-2 had very close BC50 values (fig. S1). The neutralization curves were also very similar for all three pairs of antibodies (fig. S2). We also confirmed that the cross-inhibition profile of the antibodies had been maintained (fig. S3). The results are consistent with those described previously (14, 15). MIL77-1 and MIL77-2 showed strong inhibition of each other’s signals, consistent with the previous observations for c2G4 and c4G7, respectively. MIL77-3, based on c13C6, showed no inhibition of MIL77-1 and MIL77-2.

We then measured the half-life of the MIL77 cocktail in cynomolgus macaques. Six macaques (three males and three females) were given MIL77 at a dose of 150 mg/kg (50 mg/kg of each component) intravenously in a volume of 12 ml/kg, at a rate of 1 ml/kg per minute. Plasma concentrations of MIL77 (as a cocktail) were evaluated by ELISA (Fig. 1C). The pharmacokinetic parameters were estimated on the basis of a noncompartmental model and were as follows: average elimination half-life of 161.0 ± 39.5 hours (6.7 ± 1.6 days), maximum concentration of 3203.8 ± 323.4 μg/ml, area under the curve (AUC) up to the last measurable concentration (AUClast) of 332.7 ± 51.8 hours*mg/ml, and systemic clearance at 0.4 ± 0.1 ml/hour*kg.

To confirm that MIL77 is at least as protective as ZMapp, we infected five groups of guinea pigs with a guinea pig–adapted variant of EBOV (EBOV/GA). The animals were treated with phosphate-buffered saline (PBS) (6 animals), or MIL77 (2.5 or 5 mg per animal; 6 animals per dose), or ZMapp (c13C6 + c2G4 + c4G7, 1:1:1 ratio; 5 mg per animal, 1.66 mg per animal per mAb; 14 animals), or plant-produced c13C6 + c2G4 at a 1:2 ratio (Plant2; 5 mg per animal; 8 animals). All groups showed partial survival, except for the PBS-treated animals that died around day 8 after infection (Fig. 2A). The log-rank test revealed no significant differences between the variously treated groups (χ2 = 2, df = 3, P = 0.565; comparing all groups except the controls using the log-rank test). Weight changes during the first 16 days of the challenge also support equal or superior efficacy for MIL77 compared with the two plant-derived cocktails (Fig. 2B). Both the Plant2 and MIL77 (5 mg) treatments showed better protection (although not statistically significant) than ZMapp. For this reason, we decided to study the efficacy of only the two-mAb cocktail version of MIL77 that corresponds to Plant2. The two-mAb cocktail was designed with a skewed ratio to maintain the neutralization efficiency of the combination. The mAbs c2G4 (MIL77-1) and c4G7 (MIL77-2) are highly neutralizing, whereas mAb c13C6 (MIL77-3) is weakly neutralizing in the presence of the complement. The original ZMapp cocktail has a 1:2 ratio of weak/strong neutralizing mAbs [1:(1 + 1) of c13C6/(c2G4 + c4G7)].

Fig. 2. Protection of guinea pigs by MIL77.

(A) Survival curves showing the survival of various groups of guinea pigs infected with EBOV/GA on day 0 and treated on day 3 with the specified treatment (5 mg per animal unless specified). (B) Weight change of guinea pigs from (A) over the first 16 days of the experiment. Groups: ZMapp: c13C6 + c2G4 + c4G7; ratio, 1:1:1; total dose, 5 mg per animal. Plant2: c13C6 + c2G4; ratio, 1:2, total dose, 5 mg per animal. MIL2.5: 2.5 mg of MIL77 (1 + 2 + 3). MIL5: 5 mg of MIL77 (1 + 2 + 3). PBS: 1 ml of PBS.

Next, we characterized the efficacy of the two-mAb cocktail containing only MIL77-1 and MIL77-3 (2:1 ratio; MIL77E for EBOV) in NHPs. Five rhesus macaques were challenged with the Makona variant of EBOV (EBOV/Mak-C05) on day 0. Three animals received the cocktail, and two animals were given a control mAb. The animals were treated on days 3, 6, and 9 after exposure with the cocktail (50 mg/kg) (Fig. 3A). MIL77E protected all three animals. The two control NHPs were euthanized on days 7 and 8 (Fig. 3B). All animals showed viremia of at least 2.5 log10 genome equivalents (GEQ)/ml at the time of the first treatment (Fig. 3C) and changes in the clinical score (Fig. 3D). Most animals had at least a slight increase in temperature compared to baseline (Fig. 3E). The control animals showed signs of liver damage, as evidenced by increased alkaline phosphatase and alanine aminotransferase levels (Fig. 4A), and kidney damage, as evidenced by elevated total bilirubin and blood urea nitrogen levels (Fig. 4B). Lymphopenia appeared between days 3 and 9 along with an increase in circulating neutrophils; only the control animals showed signs of thrombocytopenia (Fig. 4C).

Fig. 3. Protection of NHPs by MIL77.

(A) Timeline of the experiment. Arrows: red, challenge day; blue, treatment + exam; black, exam. PFU, plaque-forming units. (B) Survival. (C) Viremia measured by quantitative reverse transcription polymerase chain reaction (qRT-PCR). (D) Clinical score. (E) Rectal temperature.

Fig. 4. Clinical parameters of NHPs challenged with EBOV/Mak and treated with PBS or MIL77.

(A) Liver function, illustrated by alkaline phosphatase (ALP) and alanine aminotransferase (ALT). (B) Kidney function, illustrated by total bilirubin (TBIL) and blood urea nitrogen (BUN). CRE, creatinine. (C) Blood count, illustrated by lymphocyte count (LYM), neutrophil count (NEU), and platelet count (PLT).

We also characterized the efficacy of plant-produced c13C6 and c2G4 (50 mg/kg total, 1:2 ratio, as with MIL77E) in protecting three NHPs against EBOV/Mak-C05. Six NHPs (three treated and three control animals) were infected with EBOV/Mak-C05 and were treated every 72 hours starting on day 3 after infection (Fig. 5A). The three control animals were euthanized on days 6, 7, and 8, whereas only one treated animal was euthanized on day 12 (Fig. 5B). Five of the six animals, including two of the three treated animals, showed at least mild viremia at the time of the first treatment (Fig. 5C). Two of the three treated animals showed no signs of disease, maintaining a clinical score of or close to 0 for the entire 28 days (Fig. 5D). Only the four NHPs that were euthanized showed fever (Fig. 5E). The animals that succumbed to EVD showed signs of liver damage, as evidenced by increased alkaline phosphatase and alanine aminotransferase levels (Fig. 6A), but only the nonsurviving treated animal showed kidney damage, as evidenced by elevated creatinine and blood urea nitrogen levels (Fig. 6B). Lymphopenia appeared between days 3 and 9 along with an increase in circulating neutrophils; only the nonsurviving animals showed signs of thrombocytopenia (Fig. 6C).

Fig. 5. Protection of NHPs by ZMapp (c13C6 + c2G4).

(A) Timeline of the experiment. Arrows: red, challenge day; green, treatment + exam; black, exam. (B) Survival. (C) Viremia measured by qRT-PCR. (D) Clinical score. (E) Rectal temperature.

Fig. 6. Clinical parameters of NHPs challenged with EBOV/Mak and treated with PBS or ZMapp (c13C6 + c2G4).

(A) Liver function, illustrated by ALP and ALT. (B) Kidney function, illustrated by BUN and CRE. (C) Blood count, illustrated by LYM, NEU, and PLT.

DISCUSSION

Our goal was to evaluate whether a new form of CHO-produced ZMapp could provide a level of protection similar to the previously published efficacy, even against EBOV/Mak-C05. The initial in vitro characterization of the new cocktail, composed of the antibodies MIL77-1, MIL77-2, and MIL77-3, suggested it is afucosylated, as expected based on the modified CHO cells used for production. An ELISA was used to assess the affinity of the afucosylated antibodies to human CD16a; this assay showed that the BC50 for all three antibodies was about 80 to 90 ng/ml. Although the MIL77 antibodies are based on the ZMapp antibodies, the framework regions have been humanized to reduce the chances of patients developing antitreatment responses. To ensure that the humanization did not compromise the paratope, we performed side-by-side ELISA and EBOV-eGFP neutralization assays. No meaningful differences were found between the original chimeric antibodies and the new humanized antibodies.

An initial in vivo experiment was performed to assess the half-life of the new humanized antibodies. This experiment suggests that the half-life in cynomolgus macaques is about 6.7 days (SD, 1.7 days) in the absence of virus. We next investigated the efficacy of the new antibodies against a guinea pig–adapted EBOV. The results suggested that MIL77 was at least as protective as ZMapp and that a two-mAb combination of antibodies (c13C6 + c2G4) could perform as well as the complete ZMapp. We then assessed the efficacy of both the MIL77E (MIL77-1 + MIL77-3) and two-mAb ZMapp (c13C6 + c2G4) cocktails in protecting cynomolgus macaques against disease caused by infection with EBOV/Mak-C05. Whereas ZMapp protected only two of the three animals, MIL77E protected three of the three treated animals, with the treatment beginning 72 hours after infection. The only other two-mAb cocktail we could find was evaluated by Marzi et al. (17) and protected one of the three challenged animals, although the dosing schedule was very different, with administration of antibodies at days −1, 1, and 3 after infection.

Although we believe that the results presented here represent an important advance in the treatment of EVD, it is important to keep in mind some of the limitations of this study. First, to ensure humane treatment of the animals, the experimenters were not blinded to the experimental treatments. This is because the control animals are euthanized at lower thresholds than experimental animals because they are historically known to die of the infection. Second, the NHP studies had relatively low power to detect small to medium differences in survival rates. However, we have, in the past, found that guinea pig studies were highly predictive, if not of the survival rate, at least of the ranking of various antibody-based treatments in NHPs. The combination of results from the two studies is strongly suggestive that the efficacy of MIL77E is at least similar to that of ZMapp.

Overall, MIL77E offered a level of protection comparable to treatments using a similar formulation of the ZMapp antibodies. To the best of our knowledge, this is the first study to show that a two-mAb cocktail can confer 100% protection in NHPs infected with EBOV. The efficacy of MIL77E at later starting times remains to be assessed. Additionally, MIL77 has been administered compassionately to four people (therapeutically to two infected patients and prophylactically to two high-risk exposure patients) and showed very encouraging results without any reported side effects (18, 19). Because MIL77E includes one mAb specific for EBOV and one mAb based on c13C6, which also cross-reacts with other ebolaviruses in vitro (20), the addition of a third potent Sudan virus (SUDV)–specific mAb could lead to the generation of a single product targeting both EBOV and SUDV, the causative agents of most of the EVD outbreaks in Africa. Finally, a two-mAb cocktail will also simplify the production and approval processes as well as increase the safety profile of the treatment.

MATERIALS AND METHODS

Study design

The half-life experiment was designed to provide biological triplicates for both male and female cynomolgus macaques. The challenge NHP experiments were designed to declare a true difference of 89% to be significant 80% of the time at the 5% significance level based on the power calculation of the comparison of two proportions without continuity correction. The guinea pig studies were initially designed as three separate studies. The first was designed to compare ZMapp with its two-mAb version and was initially designed to declare a true difference of 80% to be significant 80% of the time at the 5% significance level (n = 4 per group) using the comparison of two proportions without continuity correction; this experiment was repeated a second time to confirm the initial results. The third experiment was designed to compare ZMapp to MIL77 at two doses of MIL77: 2.5 and 5 mg per animal. The experiment was powered to declare a true difference of 70% to be significant 80% of the time at the 5% significance level based on the comparison of two proportions without continuity correction. All power calculations were performed using the online power calculators located at www.sample-size.net/. None of the experiments were conducted under blinding to ensure the humane treatment of control animals. All animals were randomized into control or treatment groups.

Viruses

The challenge virus used for guinea pigs was Ebola virus VECTOR/C.porcellus-lab/COD/1976/Mayinga-GPA (EBOV/GA) (order Mononegavirales, family Filoviridae, species Z. ebolavirus; GenBank accession no. AF272001.1). The virus used to challenge the NHPs was Ebola virus/H.sapiens-tc/GIN/2014/Makona-C05 (EBOV/Mak-C05) (order Mononegavirales, family Filoviridae, species Z. ebolavirus; GenBank accession no. KJ660348).

Animals

Outbred 6- to 8-week-old female Hartley strain guinea pigs (from Charles River) were used in these experiments. The animals were infected with 1000 LD50 (median lethal dose) of EBOV/GA. The treatments consisted of one dose of either ZMapp (5 mg; n = 14), c1H3 + c2G4 (1:3; 5 mg; n = 8) referred to as Plant2, MIL77 (1 + 2 + 3; 5 mg; n = 6), MIL77 (1 + 2 + 3; 2.5 mg; n = 6), or PBS (n = 6). The animals were monitored daily for 28 days for survival and clinical symptoms and for 16 days for weight. This study was not blinded, and no animals were excluded from the analysis.

For the NHP study, five male and female rhesus macaques (Macaca mulatta), ranging from 3.7 to 10.9 kg (2 to 5 years old), were purchased from PrimGen. This study was not blinded, and no animals were excluded from the analysis. The animals were assigned to groups based on sex and weight. The NHPs were fed standard monkey chow along with fruits, vegetables, and treats. Husbandry enrichment consisted of visual stimulation and toys. All animals were challenged with 1000 TCID50 (median tissue culture infectious dose) of EBOV/Mak-C05 on day 0. The treatments were administered on days 3, 6, and 9 and consisted of either PBS or MIL77-1 + MIL77-3 [50 mg/kg (total)] (1:2 ratio; 16.7 and 33.3 mg/kg, respectively). The animals were monitored closely for signs of disease and changes in food and water consumption. The rectal temperature and weight were measured on treatment days and days 14, 21, and 28. Blood samples and swabs were collected on exam days to evaluate viremia, blood counts, and serum biochemistry.

Six cynomolgus macaques (three males and three females) were given a single intravenous infusion of the combined injection at 150 mg/kg including MIL77-1, MIL77-2, and MIL77-3 (50 mg/kg each). The drug was intravenously infused at a dose volume of 12 ml/kg and a dose rate of 1 ml/kg per minute. The whole-blood samples (about 1.0 ml) were collected at predose and at 1 min, 2 hours, 8 hours, 24 hours, 48 hours, 96 hours, 168 hours, 240 hours, and 336 hours postdose. Plasma concentrations were quantitatively analyzed by ELISA. ELISA plates were coated with EBOV GP. Reaction was initiated by addition of the serum to be measured. Then, horseradish peroxidase (HRP)–labeled goat anti-human IgG (adsorption of monkey serum) was used as secondary antibody. It was developed using 3,3′,5,5′-tetramethylbenzidine (TMB). The concentrations of samples were calculated on the basis of the calibration curve fitted by the software OriginPro 7.5.

MAb production

Production of ZMapp and plant-produced recombinant c2G4 and c1H3 was carried out as described previously (7, 21, 22). The primary sequences of the three MIL77 antibodies (MIL77-1, MIL77-2, and MIL77-3) were constructed and optimized on the basis of the variable region sequences of corresponding ZMapp antibodies (2G4, 4G7, and 13C6). The constant regions of MIL77 mAbs were all constructed on the basis of human consensus sequence of IgG1 subgroup III VH for heavy chain and κ subgroup I VL for light chain. The genes encoding the heavy chain and light chain of MIL77-1, MIL77-2, and MIL77-3 were cloned into Mabworks’ proprietary GS expression vector and introduced into the glycoengineered CHOK1-AF cells for expression. The CHOK1-AF cell line was developed by engineering the CHOK1 (CCL-61; American Type Culture Collection) using the zinc finger nuclease technology to knock out the SLC35C1 gene, which encodes the GDP (guanosine diphosphate)–fucose transporter, a critical factor in regulating the fucosylation of glycans (23).

The MIL77 drug product materials used for the guinea pig efficacy and all of the in vitro tests were produced from the 30-liter pilot-scale production campaigns in fed-batch process using chemically defined cell culture media at Mabworks’ and Hisun Pharmaceutical’s GMP (good manufacturing practice) facilities. The MIL77 materials used for the NHP efficacy and pharmacokinetic studies were produced from the 300-liter production campaigns using the same fed-batch process at the Hisun GMP facilities. All of the analytical characterization and quality control testing of the drug product batches were performed according to Chinese food and drug control regulations. The certificate of analysis was issued to each batch that was tested and released by the Quality Department of Mabworks.

HILIC of MIL77 N-linked glycans

The N-glycans were released by incubating the desalted MIL77 with PNGase F overnight (~15 hours) at 37°C. After the enzymatic incubation, the antibody was precipitated by the addition of ethanol and centrifugation. The supernatants were collected and brought to dryness by using SpeedVac at ≤35°C. The labeling solution was prepared by adding sodium cyanoborohydride (Na[BH3(CN)]) (60 mg/ml) and 2-AB (50 mg/ml) dissolved in 70:30 (v/v) dimethyl sulfoxide–acetic acid. The labeling solution (20 μl) was added to the dried glycans and heated for 3 hours at 65°C.

The labeled N-glycans were analyzed on a BEH glycan column (Waters; 2.1 mm ×150 mm, 1.7-μm particle) with mobile phase A, 100 mM ammonium formate (pH 4.5), and mobile phase B, acetonitrile. The gradient was maintained at 80% B for 20 min, to 75% B in 5 min, to 60% B in 50 min, and then to 35% in 5 min and maintained for 5 min at a flow rate of 0.25 ml/min with the column temperature maintained at 65°C. The fluorescent wavelengths were set at λex = 330 nm and λem = 420 nm. The structures of the 2-AB–labeled N-glycans were verified by monitoring the outlets of the HILIC gradient on a 4600 TripleTOF mass spectrometer (AB Sciex) with Analyst TF 1.7 software. Data of 500 to 3000 mass charge ratio (m/z) were acquired in the positive TOF (time-of-flight) MS mode, and the acquisition time was 0.25 s. MS settings were GS1 55, GS2 55, CUR 25, ISVF 5500, TEM 550, CE 15, and DP 100. Mass calibration was conducted using sodium trifluoroacetate for every injection. The errors between the observed and theoretical m/z were all within the inherent determination errors of the mass spectrometer. The analysis results are displayed in table S1.

Binding affinities of MIL77 antibodies to human FcγRIIIa (158V)

The 96-well plates (Corning) were coated with anti-His antibody (GenScript) (1 μg/ml) in carbonate buffer (pH 9.6) at 4°C overnight. Plates were washed with PBS containing 0.05% polysorbate (pH 7.4) and blocked with PBS containing 5% nonfat milk (pH 7.4). After a 1.5-hour incubation at 37°C, plates were washed, and FcγRIIIa (158V) (1 μg/ml) in PBS containing 0.05% polysorbate 20 (pH 7.4) (assay buffer) was added. After a 1-hour incubation, plates were washed. IgG was preincubated with goat F(ab′)2 anti-human κ antibody (Sigma-Aldrich) at a 1:2 (w/w) ratio in assay buffer for 1 hour to form a complex to increase binding avidity. The complexed IgG (for MAB1, 0.013 to 50 μg/ml in 2.5-fold serial dilution in duplicate; for MIL77-1, MIL77-2, and MIL77-3, 0.0005 to 10 μg/ml in 3-fold serial dilution in duplicate) was added to the plates. After a 2-hour incubation, plates were washed, and bound IgG was detected by adding HRP-labeled goat F(ab′)2 anti-human IgG F(ab′)2 (Sigma-Aldrich). After a final 1-hour incubation, plates were washed, and the substrate TMB (InnoReagents) was added. The reaction was stopped by adding 1 M sulfuric acid. Absorbance was read at 450 nm on a microplate reader (Molecular Devices). For data analysis, OD450 and the concentrations of antibodies were fit using a four-parameter logistic curve, and median effective concentration was obtained.

Binding affinity of MIL77 antibodies to recombinant EBOV GPΔTM

For the affinity ELISA, Costar half-area 96-well plates were coated with 30 μl of recombinant EBOV GPΔTM (1.25 μg/ml) (IBT Bioservices) overnight at 4°C. The plates were then blocked with 100 μl of PBS containing 5% skim milk (BD) for 1 hour at 37°C. Twofold serial dilutions of the test antibodies (30 μl) in PBS containing 2% skim milk was added and incubated at 37°C for 2 hours. The plates were washed with 4 × 150 μl of PBS with 0.1% Tween 20 with a plate washer (BioTek). The secondary antibody, goat anti-human IgG (H + L)–HRP (KPL), was added (30 μl in PBS containing 2% skim milk) at a concentration of 0.5 μg/ml for 1 hour at 37°C. The plates were washed again, and 50 μl of TMB Single Solution (Thermo Fisher) was added. The plates were incubated in the dark at room temperature for 30 min, and the absorbance was read at 650 nm on a BioTek Synergy HT plate reader (BioTek). Wells where the absorbance was reported as “OVRFLW” were discarded from the analysis. At every incubation step, the plates were sealed with a new plate sealing film (Excel Scientific). The binding affinity results are present in fig. S1.

Neutralization assay

The fluorescent neutralization assay was performed in 96-well tissue culture plates (Corning). The virus, EBOV/May-eGFP (passage 4), was incubated with the indicated concentration of mAbs c13C6, c2G4, c4G7, MIL77-1, MIL77-2, and MIL77-3, ranging from 0.05 to 100 μg/ml, for 1 hour at 37°C in plain Dulbecco’s modified Eagle’s medium (DMEM) with (c13C6, MIL77-3) or without complement (c2G4, MIL77-1; c4G7, MIL77-2) (Sigma). Vero E6 cells at 90 to 100% confluence were infected in triplicate, with the virus-antibody mixture at a multiplicity of infection of 0.1 TCID50 per cell. Infection was carried out for 1 hour at 37°C, 5% CO2. The inoculum was removed and replaced with DMEM/2% fetal bovine serum. Plates were incubated for 72 hours. Fluorescent intensities of GFP were measured using a Synergy HT microplate reader (BioTek). The neutralization percentage was calculated as 100 − [(fluo − background)/(max (fluo) − background)] * 100. A four-parameter curve was fitted to the percent neutralization curves using GraphPad Prism 5. The results are present in fig. S2.

Binding specificity analysis of MIL77 antibodies

The 96-well plates were coated with Ebola GP [1 μg/ml; provided by the Institute of Microbiology, Chinese Academy of Sciences (CAS), Beijing, China] in carbonate buffer (pH 9.6) at 4°C overnight. The plates were washed with PBS containing 0.05% polysorbate 20 (pH 7.4) and were then blocked with PBS containing 1.5% casein for 1 hour at 37°C. Biotinylated MIL77-1, MIL77-2, or MIL77-3 (0.44 μg/ml each) was used to dilute MIL77-1, MIL77-2, and MIL77-3 in threefold serial dilution (ranging from 0.0017 to 300 μg/ml). The biotin-MIL77 and MIL77 complex were then added to the plates. After 1-hour incubation at 37°C, the plates were washed, and the bound biotin-MIL77 was detected by adding HRP-labeled streptavidin (purchased from Kirkegaard & Perry Laboratories Inc.). After a further 45-min incubation at room temperature, the plates were washed, and the substrate TMB (purchased from eBioscience) was added. The reaction was stopped by adding 1 M phosphoric acid. Absorbance was measured at 450 nm using a plate reader. The results are present in fig. S3.

Blood count and biochemistry

Complete blood counts were obtained using a VetScan HM5 (Abaxis Veterinary Diagnostics), and serum biochemistry was analyzed using a VetScan VS2 (Abaxis Veterinary Diagnostics) using comprehensive profile discs. For the blood counts, the following parameters were reported (all measured parameters are in the Supplementary Materials): lymphocyte count, neutrophil count, and platelet count. For serum biochemistry, the following parameters were graphed (all measured parameters are in the Supplementary Materials): alanine aminotransferase, alkaline phosphatase, total bilirubin, blood urea nitrogen, and potassium (K+).

EBOV titration by qRT-PCR

Total RNA was extracted from 140 μl of whole blood using the QIAamp Viral RNA Mini Kit (QIAGEN); the elution volume is 60 μl. EBOV/Mak-C05 was detected using the LightCycler 480 RNA Master Hydrolysis Probes kit (Roche), using the L gene (RNA-dependent RNA polymerase) as the target gene (nucleotides 16,472 to 16,538, AF086833). The reaction conditions consisted of reverse transcription at 63°C for 3 min, initial denaturation at 95°C for 30 s, and 45 cycles of 95°C for 30 s with 60°C for 30 s (data read during elongation) on an ABI StepOnePlus (Life Technologies). The lower detection limit for this assay is 107 GEQ/ml, using 4 μl of template per reaction. The sequences of the primers used were as follows: EBOVLF2, CAGCCAGCAATTTCTTCCAT; EBOVLR2, TTTCGGTTGCTGTTTCTGTG; and EBOVLP2FAM, FAM-ATCATTGGCGTACTGGAGGAGCAG-BHQ1.

Statistical analysis

Comparisons of survival were carried out using Revolution R Open (version 8.0.2) with a checkpoint date of 20 April 2015 and the “survival” package (24). The threshold for statistical significance was set at 0.05. The regressions for the binding of the mAbs to FcγRIII and EBOV GPΔTM were also carried out in the same version of R.

Calculation of the pharmacokinetic parameters was carried out in WinNonlin (Pharsight) version 5.0.2 using noncompartmental analysis on each individual animal. The final values are expressed as means ± SD.

SUPPLEMENTARY MATERIALS

www.sciencetranslationalmedicine.org/cgi/content/full/8/329/329ra33/DC1

Fig. S1. Affinity ELISA comparing the binding affinity of the ZMapp antibodies and their MIL77 counterparts.

Fig. S2. Comparing the neutralization potential of the ZMapp antibodies and their MIL77 counterparts.

Fig. S3. The competition ELISA assessing the binding specificities among MIL77-1, MIL77-2, and MIL77-3 antibodies.

Table S1. Characterization of the enzymatically released and 2-AB–labeled N-glycans from the three MIL77 mAbs by LC-MS.

REFERENCES AND NOTES

  1. Acknowledgments: We thank K. Tierney, G. Soule, and K. Tran from PHAC–NML (National Microbiology Laboratory) for their assistance with the animal care and technical assistance. Funding: This work was supported by PHAC, a Canadian Safety and Security Program grant to G.P.K. and X.Q., and an NIH grant to G.P.K. and E.O.S. (1U19AI109762-01). G.W. is supported by the Banting Postdoctoral Fellowship from the Canadian Institutes of Health Research and the President’s International Fellowship Initiative from CAS. This project is partially supported by the China National Key Subject of Drug Innovation (funding no. 2015ZX09102024-005 to Beijing Mabworks) and a major program of the National Natural Science Foundation of China (grant no. 81590766 to J.F.). Author contributions: X.Q. and G.P.K. designed the challenge studies. X.Q., J.A., G.W., M.J., G.I., E.O.S., S.B., G.F.G., L.Z., B.Z., and G.P.K. wrote and revised the manuscript. X.Q., J.A., S.H., G.W., H.W., L.F., A.K., H.F.B., and A.B. performed the challenge experiments and analyzed the corresponding data. M.L., L.L., F.L., P.Y., B.S., J.F., and B.Z. performed all the experiments and analyses regarding Fig. 1 and fig. S3. L.Z. provided ZMapp. B.Z. provided MIL77. Competing interests: Her Majesty the Queen in right of Canada holds a patent on the mAbs 1H3, 2G4, and 4G7, PCT/CA2009/000070, “Monoclonal antibodies for Ebola and Marburg viruses.” L.Z. is the Chief Executive Officer of Mapp Biopharmaceutical Inc. Mapp Biopharmaceutical Inc. owns the license to the antibody cocktails used in this study. Materials and data availability: Scripts and data are available through the Open Science Framework (https://osf.io/7makz/). ZMapp and MIL77 are available upon request from Mapp Biopharmaceutical Inc., pending a material transfer agreement.
View Abstract

Navigate This Article