Research ArticleMuscular Dystrophy

Proteasome inhibitors increase missense mutated dysferlin in patients with muscular dystrophy

See allHide authors and affiliations

Science Translational Medicine  20 Aug 2014:
Vol. 6, Issue 250, pp. 250ra112
DOI: 10.1126/scitranslmed.3009612

This article has been retracted. Please see:

Proteasome Inhibitors for Patients with Muscular Dystrophy

Many patients affected by muscular dystrophies due to dysferlin deficiency carry pathogenic dysferlin alleles encoding missense mutated proteins, which are degraded by the proteasome. In vitro evidence suggests that such proteins might be functional if salvaged from degradation. Administration of a proteasome inhibitor to three patients harboring a homozygous dysferlin missense mutation led to a marked increase in dysferlin in skeletal muscle and monocytes (Azakir et al.). The salvaged protein became correctly localized to the sarcolemma in muscle biopsies and retained biological activity in patient-derived myoblasts. These results lay the groundwork for long-term studies of proteasomal inhibitors for treating dysferlinopathies and possibly other genetic diseases.

Abstract

No treatment is available for patients affected by the recessively inherited, progressive muscular dystrophies caused by a deficiency in the muscle membrane repair protein dysferlin. A marked reduction in dysferlin in patients harboring missense mutations in at least one of the two pathogenic DYSF alleles encoding dysferlin implies that dysferlin is degraded by the cell’s quality control machinery. In vitro evidence suggests that missense mutated dysferlin might be functional if salvaged from degradation by the proteasome. We treated three patients with muscular dystrophy due to a homozygous Arg555Trp mutation in dysferlin with the proteasome inhibitor bortezomib and monitored dysferlin expression in monocytes and in skeletal muscle by repeated percutaneous muscle biopsy. Expression of missense mutated dysferlin in the skeletal muscle and monocytes of the three patients increased markedly, and dysferlin was correctly localized to the sarcolemma of muscle fibers on histological sections. Salvaged missense mutated dysferlin was functional in a membrane resealing assay in patient-derived muscle cells treated with three different proteasome inhibitors. We conclude that interference with the proteasomal system increases expression of missense mutated dysferlin, suggesting that this therapeutic strategy may benefit patients with dysferlinopathies and possibly other genetic diseases.

INTRODUCTION

Mutations in the dysferlin gene (DYSF) are responsible for the progressive, recessively inherited muscular dystrophies Miyoshi myopathy (1), limb-girdle muscular dystrophy type 2B (2), and distal anterior compartment myopathy (3). Dysferlin is a transmembrane protein composed of seven C2 domains and two DysF domains (4) and is expressed predominantly in skeletal muscle and cardiac muscle and in blood monocytes (5). Dysferlin has been implicated in sarcolemmal repair (6) because muscle fibers from dysferlin-deficient mice are unable to efficiently repair membrane wounds induced by laser injuries (7). Pathogenic dysferlin mutations in patients reported thus far reduce dysferlin protein in skeletal muscle (4). A marked reduction in dysferlin due to missense mutations suggests that the mutated protein is recognized and degraded by the cell’s quality control system. We reasoned that some of the eliminated missense mutated dysferlin might be functional if salvaged from degradation and have shown that dysferlin carrying an Arg555Trp missense mutation can be markedly increased through inhibition of the proteasomal system in patient-derived cultured myoblasts (8). The salvaged missense mutated protein was functional in vitro because it reversed plasma membrane resealing defects and restored impaired myotube formation (8).

To translate those in vitro findings into clinical application, we have administered single doses of the Food and Drug Administration (FDA)–approved proteasome inhibitor bortezomib at 1.3 mg/m2 either intravenously or subcutaneously to three patients with dysferlin-deficient muscular dystrophy, who are homozygous for the Arg555Trp DYSF missense mutation. We monitored dysferlin expression in skeletal muscle by obtaining serial muscle biopsies, and in blood monocytes. We demonstrate that bortezomib increased missense mutated dysferlin in skeletal muscle and in monocytes in vivo. The salvaged mutant dysferlin protein correctly localized to the sarcolemma of muscle fibers in patients and was functional in a membrane resealing assay in patient-derived myoblasts. Newer-generation proteasome inhibitors were also capable of increasing dysferlin in cultured, patient-derived myoblasts and restored the membrane resealing capacity of these cells.

RESULTS

Three brothers aged 30 (patient 1), 26 (patient 2), and 28 (patient 3) years with dysferlinopathy that emerged in their teenage years presented with a proximo-distal distribution of muscle weakness. Creatine kinase concentrations were 6149, 5498, and 5688 U/liter in patients 1, 2, and 3, respectively (normal <200 U/liter). Western blot analysis of skeletal muscle and monocytes showed markedly reduced dysferlin expression (Figs. 1, A and D, 2, A and B, and tables S1 and S2). DNA sequencing confirmed a 1663C>T complementary DNA (cDNA) homozygous mutation in the DYSF gene resulting in an Arg555Trp dysferlin protein mutation in the three clinically affected brothers; both clinically unaffected parents carried a 1663C>T cDNA heterozygous mutation (fig. S1). In all three patients, both intravenous and subcutaneous single-dose administrations of bortezomib were effective in reducing the chymotrypsin-like proteolytic activity of the proteasome’s multicatalytic proteinase complex in skeletal muscle (Fig. 1, A and D, and table S1). The chymotrypsin-like proteasome activity in skeletal muscle was inhibited by 70% within 8 hours after intravenous injection and gradually recovered over 96 hours (Fig. 1A). These results show that bortezomib can effectively reach skeletal muscle and transiently inhibit its proteasome activity.

Fig. 1. Effect of intravenous or subcutaneous bortezomib administration on dysferlin expression.

(A to E) Effect of intravenous (i.v.) (A to C) or subcutaneous (s.c.) (D and E) bortezomib administration on dysferlin expression in skeletal muscle in three muscular dystrophy patients with a homozygous Arg555Trp DYSF mutation. Upper panels in (A) and (D) show the specific chymotrypsin-like proteasome activity (solid line) and dysferlin amounts as measured by Western blotting (bars) in total soluble protein extracts from quadriceps muscle biopsies. Chymotrypsin-like activity was normalized to the 26S proteasome content in each sample obtained from the three patients after bortezomib injection. Solid line represents the mean values of the normalized proteasome activity for all three patients (+SD). Western blots of muscle protein extracts, shown in lower panels in (A) and (D), were stained with anti-dysferlin antibody and with anti–actin-α1 antibody to normalize the amount of muscle tissue present in the biopsy extract. To load an equal amount of muscle proteins, 40 to 50 μg of total protein was loaded for the control (C1 and C2) muscle extracts, and 75 to 120 μg for the patient muscle extracts. Bars in (A) and (D) depict the mean values (+SD) of the ratio between dysferlin and actin-α1 in all three patient skeletal muscle samples at the indicated time points after bortezomib administration, normalized to the ratio between dysferlin and actin-α1 in control 1 (C1), which was taken as 100% (*P < 0.05; **P ≤ 0.01). (B, C, and E) Immunohistochemical analysis of the muscle biopsies of patient 3 collected at the indicated time points after intravenous (B) or subcutaneous (E) bortezomib injection and stained with anti-dysferlin and anti-dystrophin antibodies. The dysferlin staining is color-coded between intensity 0 (no signal) and intensity 255 (saturated) in steps as shown in the inserted scheme. Scale bar, 100 μm. (C) Three-dimensional reconstruction of selected images presented in (B) to visualize the localization, but not intensity, of dysferlin expression. Scale bar, 50 μm.

Fig. 2. Effect of bortezomib administration on dysferlin expression in monocytes.

(A and B) Upper panels show the chymotrypsin-like proteasome activity (solid line) in total soluble protein extracts of monocytes normalized to the 26S proteasome content in each sample obtained from two (A, intravenous) or three (B, subcutaneous) patients after bortezomib administration (+SD); n.d., not determined. Dysferlin was determined by Western blotting (bars) in total soluble protein extracts of monocytes stained with anti-dysferlin antibody and anti-CD14 antibody. Bars in (A) depict the ratio between dysferlin and CD14 in patient 2 (open bars) and patient 3 (filled bars), expressed as a percentage of the ratio between dysferlin and CD14 in control 3 (C3, gray bar). Bars in (B) depict the mean values (+SD) of the ratio between dysferlin and CD14 in the monocytes of all three patients at the indicated time points after subcutaneous bortezomib administration, expressed as a percentage of the ratio between dysferlin and CD14 in control 3 (C3) (*P < 0.05; **P ≤ 0.01; ***P ≤ 0.001).

We measured dysferlin expression by Western blot in muscle biopsies obtained before and at the indicated times after bortezomib administration. At baseline, no or only trace amounts of dysferlin were detected in muscle biopsies of the three patients. After a single systemic dose of bortezomib, either by intravenous or by subcutaneous injection, dysferlin expression markedly increased, reaching maximal amounts approaching ~30% of control muscle values at 36 to 48 hours after injection as estimated by densitometric analysis of Western blot dysferlin normalized to actin-α1 (Fig. 1, A and D, and table S1); dysferlin could still be detected at about 10% of control levels at 96 hours after injection (Fig. 1A).

Immunohistochemistry with an antibody directed against the C terminus of dysferlin revealed no detectable or only trace amounts of sarcolemma-localized dysferlin in muscle biopsies obtained before treatment (Fig. 1, B, C, and E). Within 24 hours after bortezomib administration, most of the muscle fibers showed marked expression of dysferlin in the sarcolemma (Fig. 1, B, C, and E).

To verify that the observed increase in dysferlin expression was due to the effect of bortezomib and not due to increased expression in regenerating myofibers originating from injuries caused by repeated muscle biopsies (9), we biopsied at 48 hours and thereafter the contralateral quadriceps muscle. Dysferlin expression remained high at 48 hours and declined thereafter (Fig. 1, A and D).

Given that dysferlin is also expressed in monocytes, we sought to evaluate its expression in these cells after bortezomib treatment. Analogous to skeletal muscle, maximal inhibition of the proteasome activity in monocytes was observed as early as 8 hours after intravenous bortezomib administration (Fig. 2A). Dysferlin increased in monocytes of all three patients after a single intravenous or subcutaneous dose of bortezomib. Maximal dysferlin was observed 36 to 48 hours after treatment (Fig. 2, A and B, and table S2).

To demonstrate the biological functionality of the salvaged missense mutated dysferlin protein, we performed membrane resealing experiments on primary myoblasts derived from percutaneous muscle biopsies taken from patient 2. Bortezomib treatment of primary myoblasts increased dysferlin expression in a dose-dependent manner (Fig. 3A), and bortezomib-treated myoblasts regained their capability to reseal laser-induced plasma membrane injuries (Fig. 3B and table S3A).

Fig. 3. Effect of different proteasome inhibitors on dysferlin expression and on membrane resealing in cultured primary myoblasts.

(A, C, and E) Primary myoblasts from patient 2 harboring a homozygous Arg555Trp DYSF mutation that were treated with the indicated amounts of bortezomib (A), carfilzomib (C), or MLN2238 (E) for 24 hours. Western blots of protein extracts were stained with anti-dysferlin antibodies and with anti–α-tubulin antibody as loading control. (B, D, and F) Quantitative data of relative fluorescence intensity over time after laser-induced injury [as previously described (8)] of patient-derived myoblasts treated with the indicated amounts of bortezomib (B), carfilzomib (D), or MLN2238 (F), as well as untreated control myoblasts (C4; control 4); data are presented as means (+SD). Resealing experiments in (D) and (F) were performed simultaneously using the same untreated patient-derived myoblasts. Number of laser-induced injuries: n = 14 to 16 cells per condition.

To demonstrate that treatment with proteasome inhibitors other than bortezomib can also salvage missense mutated dysferlin, we treated primary myoblasts from patient 2 with either the irreversible proteasome inhibitor carfilzomib, a tetrapeptide epoxyketone (10), or MLN2238 (11), which is the biologically active, hydrolyzed form of the investigational, reversible proteasome inhibitor ixazomib (MLN9708) being developed for oral application. Both inhibitors were reported to have less neuropathic side effects as compared to bortezomib (1215). We found that treatment with either of these newer-generation proteasome inhibitors resulted in a dose-dependent increase in dysferlin expression (Fig. 3, C and E) and that treated myoblasts regained their capability to reseal laser-induced plasma membrane injuries (Fig. 3, D and F, and table S3B).

To investigate whether treatment strategies aimed at interference with the proteasomal system could have broader applicability, we treated myoblast cultures derived from two dysferlinopathy patients harboring one null allele and missense mutations other than Arg555Trp in their second pathogenic DYSF allele. Myoblasts harboring the DYSF missense mutation Gly426Arg or Gly299Arg regained resealing capabilities after addition of bortezomib (Fig. 4 and table S4).

Fig. 4. Proteasome inhibition restores membrane resealing in cultured human myoblasts harboring one missense and one null DYSF allele.

(A and C) Representative time series images of laser-induced plasma membrane injuries taken during the membrane repair assay performed on patient-derived dysferlin-deficient myoblasts harboring the DYSF missense mutation Gly299Arg (A and B) or Gly426Arg (C and D) incubated with the indicated concentrations of bortezomib for 24 hours. An increase of fluorescence at the injury site of untreated myoblasts (0 nM bortezomib) indicates impaired membrane resealing. Lack of or minimal fluorescence increase at the injury site (10 or 50 nM bortezomib) indicates successful resealing of the injured plasma membrane. Scale bar, 1 μm. (B and D) Quantitative data of relative fluorescence intensity over time after laser-induced injury of myoblasts treated with 0, 10, or 50 nM bortezomib. Data are presented as means (+SD). Number of laser-induced injuries: n = 13 to 18 cells per condition.

DISCUSSION

No pharmacological treatment is yet available for patients affected by the progressive and debilitating muscular dystrophies caused by dysferlin deficiency. Current therapeutic strategies that are being tested in cell culture and in animal models include exon skipping (16, 17), expression of small dysferlin fragments suitable for adeno-associated virus (AAV)–mediated gene delivery (18, 19) or fragments that recombine to form full-length dysferlin after AAV-mediated gene transfer (20, 21), stop codon readthrough by PTC124 (Ataluren) (22), peptides to relocate mutated dysferlin (23), and cell-based therapies using mesangioblasts (24).

Our results show that systemic administration of the proteasome inhibitor bortezomib to muscular dystrophy patients with a homozygous Arg555Trp missense mutation in the DYSF gene encoding dysferlin leads to a marked increase in dysferlin in skeletal muscle and in monocytes. The salvaged dysferlin protein becomes correctly localized to the sarcolemma in muscle fibers in patients and is functional in a membrane resealing assay in patient-derived myoblasts. No clinical or surrogate endpoints (that is, serum creatine kinase concentrations) were investigated in this proof-of-concept study involving single-dose administrations of bortezomib and repeated muscle biopsies, which likely caused local injury and creatine kinase release.

In all three patients treated with a single systemic dose of bortezomib, dysferlin levels in skeletal muscle reached 30% of the level in control muscle at 36 to 48 hours and remained at about 10% of control levels even at 96 hours. We previously reported a patient who expressed an internally truncated dysferlin protein at only 10% of normal levels and presented with a very mild muscular dystrophy phenotype (25). It is therefore conceivable that the amount of dysferlin attained in the three patients treated with bortezomib in this study could be sufficient to alleviate the muscular dystrophy phenotype if the treatment were used long-term. On the basis of the kinetics of accumulation and disappearance of the salvaged Arg555Trp mutant dysferlin in the bortezomib-treated patients, intermittent dosing at weekly intervals may be a treatment regimen suitable for long-term clinical studies. The once-weekly bortezomib administration has been shown to be associated with fewer neuropathic side effects compared to the twice-weekly standard regimen for the treatment of multiple myeloma (26).

The treatment strategy proposed in this work might be applicable to a wide array of DYSF missense mutations because proteasome inhibition restored membrane resealing function in myocytes from patients with at least two additional DYSF missense mutations in vitro. Further studies will need to address which additional dysferlin missense mutations are amenable to this treatment approach and what dysferlin expression levels can be achieved in vivo in patients harboring only one DYSF missense allele in combination with a DYSF null allele. The strategy of therapeutic interference with the proteasomal system to salvage expression of missense mutated but functional proteins might be transferable to other genetic diseases, and may also use compounds targeting components of the protein degradation pathway upstream of the proteasome.

Peripheral neuropathy is one of the most frequent dose-limiting side effects of bortezomib treatment in patients with multiple myeloma (27). Neurotoxicity is dependent on the dose (28), frequency (26, 29), and route of bortezomib administration (30). Myeloma-related factors (27), genetic factors (31), and combination therapy with other neurotoxic drugs (32) represent additional important risk factors. Patients with diseases other than myeloma may have a reduced risk of developing peripheral neuropathy (33). Accordingly, strategies to reduce the neurotoxicity of bortezomib include increasing the dosing interval (26, 29), use of subcutaneous instead of intravenous administration (30), and dose reduction (28).

In our study, bortezomib had comparable effects on the expression of missense mutated dysferlin when given subcutaneously or intravenously, opening the possibility of reducing potential side effects in case of long-term treatment and also facilitating inhibitor administration. Newer-generation proteasome inhibitors, for example, the recently FDA-approved carfilzomib and ixazomib, the latter being in phase 3 clinical development as the first orally available proteasome inhibitor, are also associated with fewer neuropathic side effects compared to bortezomib (1215). Both carfilzomib and MLN2238 (the hydrolyzed, active form of ixazomib) have shown efficacy in our in vitro assays similar to that of bortezomib. Carfilzomib and ixazomib therefore are attractive candidates for further in vivo studies.

The question of whether the salvaged missense mutated dysferlin protein will be able to alleviate the clinical dysferlinopathy phenotype can only be answered by long-term clinical trials and possibly by testing this strategy in DYSF missense knock-in mouse models. Such models would need to be generated because currently available dysferlin-deficient mouse models do not carry any missense mutations (7, 34, 35).

In summary, on the basis of our proof-of-concept study, we propose a strategy for the treatment of dysferlinopathies with certain missense mutations that destabilize the dysferlin protein and lead to its degradation. Clinical outcome in relation to selection of the proteasome inhibitor, its dose, frequency of administration, and treatment duration will need to be evaluated in further prospective studies. This strategy may be applicable also to other genetic diseases in which missense mutated but functional proteins are targeted for proteasomal degradation.

MATERIALS AND METHODS

Study oversight

The study was approved by the Ethics Committee of Basel (EKBB, no. 238/11) and the Swiss Agency for Therapeutic Products (Swissmedic, no. 2011DR1148), registered at http://www.clinicaltrials.gov (NCT01863004) and monitored by the Clinical Trial Unit of the University Hospital Basel, Switzerland. All participants gave written informed consent.

Study design

In this prospective open-label single-arm study, the objective was to investigate the effect of the systemic administration of a single dose of the proteasome inhibitor bortezomib on the expression of dysferlin in dysferlinopathy patients harboring at least one missense mutated DYSF allele. Inclusion criteria, as outlined in http://www.clinicaltrials.gov (NCT01863004), were as follows: “salvageable” missense mutation of dysferlin (that is, a missense mutated dysferlin protein that regains resealing capabilities of laser-injured muscle cell surface membranes in vitro when salvaged from degradation), reduced amounts of dysferlin protein in muscle tissue on Western blot analysis, age ≥18 years, willingness to use a double barrier contraception during the study period, and written informed consent. Exclusion criteria were bleeding disorder; acute or chronic renal failure (creatinine clearance less than 50 ml/min); advanced liver disease or active hepatitis; congestive heart failure NYHA (New York Heart Association) III and IV; pregnancy or nursing; immunosuppression (prednisolone doses less than 20 mg/day were allowed); concomitant therapy with strong inhibitors of cytochrome P450 3A4; HCV or HIV infection; regular alcohol consumption (>14 drinks a week); and drug addiction. The amount of dysferlin in skeletal muscle tissue was defined as the primary endpoint. Secondary endpoints were the degree of proteasome inhibition in skeletal muscle tissue and dysferlin amounts in monocytes. Serious adverse events were defined as a safety endpoint. Primary and secondary endpoints have been prospectively described in the study protocol. In this proof-of-concept study, no sample size calculation has been performed. No statistical correction was applied, and no outliers were excluded. Serious unexpected adverse events or the availability of new safety information that could endanger study participants were defined as stopping rules.

Bortezomib administration

The patients received a single intravenous dose (1.3 mg/m2) of bortezomib (Velcade, Janssen-Cilag AG). Repeated percutaneous muscle biopsies of skeletal muscle were performed, and blood was collected at the indicated times to monitor dysferlin expression in skeletal muscle and monocytes. Because subcutaneous injections of bortezomib have been reported to be associated with fewer side effects when administered long-term (30), we wished to compare the effects of subcutaneous and intravenous administrations on dysferlin expression. After an interval of at least 12 days after intravenous injection, when dysferlin levels had decreased to the pretreatment levels, a single subcutaneous dose (1.3 mg/m2) of bortezomib was given at the abdomen. A mild, transient injection-site reaction (redness) was associated with the subcutaneous injection in patient 1.

Genetic studies

DNA was isolated from blood, and amplicons encompassing exons 18 and 19 were generated by polymerase chain reaction with DYSF primers exon18_forward: CGTGGCGTTCTTCTTTATACACTGAC and exon19_reverse: TGATTTATTCCCACTTTACAGCTGAGA, and then Sanger-sequenced.

Muscle biopsies

Percutaneous muscle biopsies were performed using disposable core biopsy instruments (Max-Core, Bard and Biopince, Angiotech) at the indicated time points. Biopsies were taken after local anesthesia from one quadriceps muscle at time points up to and including 36 hours, and from the contralateral quadriceps muscle thereafter. Control quadriceps muscle biopsies (C1 and C2) were obtained from age- and gender-matched subjects, who were biopsied for nonspecific symptoms and who showed no obvious myopathology.

Western blotting

Proteins were extracted from muscle biopsies and from monocytes with a buffer containing 50 mM Hepes (pH 7.4), 150 mM NaCl, 20 mM Na-pyrophosphate, 20 mM Na-orthovanadate, 1 mM MgCl2, 1.25% Triton X-100, 5% glycerol, and a protease inhibitor cocktail, as previously described (8); separated on SDS-polyacrylamide gels; and immunoblotted on polyvinylidene difluoride membranes with mouse monoclonal anti-dysferlin antibody, clone HAM-1 (Vector Laboratories), rabbit polyclonal anti–α skeletal muscle actin (actin-α1) antibody (Abcam), goat polyclonal anti-CD14 antibody (Abcam), and rabbit polyclonal anti–α-tubulin antibody (Abcam). Membranes were incubated with secondary antibodies Alexa Fluor 680 goat anti-mouse immunoglobulin G (IgG) (Rockland), IRDye 800 goat anti-rabbit IgG (Rockland), or IRDye 800 donkey anti-goat IgG (Rockland). Densitometric analysis of Western blot signals was performed using ImageJ v.1.43u (National Institutes of Health).

Immunohistochemistry

Ten-micrometer-thick sections were mounted on SuperFrost Plus glass slides (Thermo Scientific), fixed in neutrally buffered (10%) formaldehyde solution (Merck), and delipidated in 80% methanol. Sections were then blocked with 1% normal goat serum (Jackson ImmunoResearch), 2% fish skin gelatin (Sigma-Aldrich), and 0.15% Triton X-100 (Sigma-Aldrich) in phosphate-buffered saline (PBS). Dysferlin was detected with mouse monoclonal anti-dysferlin antibody, clone HAM-1 (Vector Laboratories); dystrophin was detected on consecutive sections with a mouse monoclonal anti-dystrophin antibody, MANEX7374R(8A12) (Developmental Studies Hybridoma Bank, University of Iowa). After being washed with PBS, the sections were incubated with a secondary goat anti-mouse IgG-Cy3 antibody (Jackson ImmunoResearch).

Image analysis

Images were acquired using identical camera settings and were processed using the AnalySIS D image analysis software (SIS). To compare the intensities, the signal intensity was color-coded as follows: black, intensity 0 to 17; blue, 18 to 22; green, 23 to 27; yellow, 28 to 40; orange, 41 to 70; red, greater than 71. For higher resolution and analysis of the local distribution of dysferlin, a confocal microscope LSM710 (Zeiss) with a 63× oil immersion objective (Zeiss Plan-Apochromat 63×/numerical aperture 1.40 oil) was used, and image series were taken at constant conditions.

Monocyte purification

Peripheral blood mononuclear cells (PBMCs) were isolated from whole blood using Ficoll-Plaque Plus (GE Healthcare) according to the manufacturer’s instructions. Monocyte isolation from PBMCs was carried out using mouse monoclonal anti-human CD14 antibody–coated beads (Miltenyi Biotec) according to the manufacturer’s instructions. Positive control monocytes were purified from blood of a healthy donor (C3).

Cell culture

Primary myoblasts harboring the homozygous Arg555Trp mutation were cultured from a percutaneous muscle biopsy taken from patient 2 as described (36) and purified using mouse monoclonal anti-human CD56 antibody–coated beads (Miltenyi Biotec) according to the manufacturer’s instructions. Myoblasts were maintained in skeletal muscle cell growth medium (PromoCell). Dysferlin-positive human myoblast cultures (C4) were a gift from M. Moggio (Ospedale Maggiore Policlinico, Milan, Italy) and were maintained under the same conditions. Patient-derived immortalized dysferlin-deficient myoblasts harboring one Gly299Arg (cDNA 895G>A) DYSF missense allele and one DYSF null allele (cDNA 855+1delG) (37) were provided by S. Spuler (Experimental and Clinical Research Center, Charité University Hospital, Berlin, Germany). Patient-derived immortalized dysferlin-deficient myoblasts harboring one DYSF Gly426Arg (cDNA 1276 G>A) missense allele and one DYSF null allele (cDNA 5979dupA) were provided by T. Taivassalo and E. Shoubridge (McGill University, Montreal, Canada). Confluent myoblasts from patient 2 were incubated with the indicated concentrations of the proteasome inhibitor bortezomib, carfilzomib, or MLN2238 (all from Selleckchem) for 24 hours.

Proteasomal activity

The chymotrypsin-like activity of the proteasome in muscle tissue and monocytes was determined in triplicates by cleavage of the luminogenic substrate (Suc-LLVY-Glo, Promega) as described (38). Forty micrograms of proteins from each sample were separated on SDS–polyacrylamide gel electrophoresis and blotted with mouse monoclonal anti–26S proteasome antibody (Abcam). Densitometric analysis of Western blot signals was performed using ImageJ v.1.43u.

Membrane resealing assay

Laser-induced membrane injuries and measurements of the resealing kinetics of cultured myoblasts were performed as previously described (8).

Statistical analysis

Statistical analyses were performed using a paired one-tailed Student’s t test. P < 0.05 was considered statistically significant. Results are expressed as means + SD of independent experiments.

SUPPLEMENTARY MATERIALS

www.sciencetranslationalmedicine.org/cgi/content/full/6/250/250ra112/DC1

Fig. S1. DYSF mutational analysis of study participants.

Table S1. Effect of bortezomib administration on dysferlin expression levels in skeletal muscle in three muscular dystrophy patients with a homozygous Arg555Trp DYSF mutation.

Table S2. Effect of bortezomib administration on dysferlin expression levels in monocytes.

Table S3. Effect of different proteasome inhibitors on dysferlin expression and membrane resealing in cultured primary myoblasts from a patient harboring a homozygous Arg555Trp DYSF mutation.

Table S4. Proteasome inhibition restores membrane resealing in human cultured myoblasts harboring one missense and one null DYSF allele.

REFERENCES AND NOTES

  1. Acknowledgments: We thank the patients for their participation in the study. We thank A. Nalini (National Institute of Mental Health and Neurosciences, Bangalore, India) and the Jain Foundation for identifying and diagnosing the patients. We thank L. Kappos for support and critical review of the study. We thank S. Spuler (Experimental and Clinical Research Center, Charité University Hospital, Berlin, Germany) and T. Taivassalo and E. Shoubridge (McGill University, Montreal, Canada) for providing patient-derived myoblast cultures. We thank Telethon Biobank, supported by Telethon grants (project no. GTB07001), for providing control myoblast cultures. We thank S. Treves (Department of Biomedicine, University Hospital Basel) for help with the primary myoblast cultures. We thank T. Wiktorowicz and J. Kinter for DNA sequence analysis. We thank the Clinical Trial Unit of University Hospital Basel for support. We thank J. Halter for helpful discussions and critical review of the manuscript. Funding: This study was funded by the Gebert-Rüf Foundation, the Uniscientia Foundation, the Neuromuscular Research Association Basel, the Association Française contre les Myopathies, the Swiss National Science Foundation, the Swiss Foundation for Muscle Research, and Myosuisse. B.A.A. was funded by the Gebert-Rüf Foundation, the Uniscientia Foundation, and the Swiss National Science Foundation. S.D.F. was funded by the Association Française contre les Myopathies and the Swiss National Science Foundation. Author contributions: B.A.A. designed and performed Western blot, proteasome activity, cell culture, and laser injury experiments; analyzed data; and wrote the manuscript. B.E. performed immunohistochemical experiments, analyzed data, and wrote the manuscript. S.D.F. performed cell culture and laser injury experiments, analyzed data, and wrote the manuscript. G.S. participated in the design of the study, obtained ethics and Swissmedic approval, analyzed data, and wrote the manuscript. M.S. designed and supervised the study, analyzed data, performed muscle biopsies, and wrote the manuscript. Competing interests: The authors declare that they have no competing commercial or financial interests.
View Abstract

Navigate This Article