Erratum

Erratum for the Research Article: “A Common Mutation in the Defensin DEFB126 Causes Impaired Sperm Function and Subfertility” by T. L. Tollner, S. A. Venners, E. J. Hollox, A. I. Yudin, X. Liu, G. Tang, H. Xing, R. J. Kays, T. Lau, J. W. Overstreet, X. Xu, C. L. Bevins, G. N. Cherr

Science Translational Medicine  14 May 2014:
Vol. 6, Issue 236, pp. 236er3
DOI: 10.1126/scitranslmed.3009423

See original article:

In the article “A Common Mutation in the Defensin DEFB126 Causes Impaired Sperm Function and Subfertility,” Table 5 contained a typographical error in the sequence of DEFB126-409a. This error was solely in the text of the manuscript and did not reflect the sequence of the oligonucleotide used in our experiments or influence the experimental findings or conclusions of the paper. The sequence of DEFB126-409a should have been 5′- CCTCTTTGCTTTAATGAGTCGGG - 3′, and not 5′- CCACAATGCTTTAATGAGTCGGG- 3′. The full text and PDF have been corrected.

Navigate This Article

  1. Article
  2. Info & Metrics
  3. eLetters