Research ArticleGene Therapy

Gene Therapy for Wiskott-Aldrich Syndrome—Long-Term Efficacy and Genotoxicity

See allHide authors and affiliations

Science Translational Medicine  12 Mar 2014:
Vol. 6, Issue 227, pp. 227ra33
DOI: 10.1126/scitranslmed.3007280

This article has a correction. Please see:

Abstract

Wiskott-Aldrich syndrome (WAS) is characterized by microthrombocytopenia, immunodeficiency, autoimmunity, and susceptibility to malignancies. In our hematopoietic stem cell gene therapy (GT) trial using a γ-retroviral vector, 9 of 10 patients showed sustained engraftment and correction of WAS protein (WASP) expression in lymphoid and myeloid cells and platelets. GT resulted in partial or complete resolution of immunodeficiency, autoimmunity, and bleeding diathesis. Analysis of retroviral insertion sites revealed >140,000 unambiguous integration sites and a polyclonal pattern of hematopoiesis in all patients early after GT. Seven patients developed acute leukemia [one acute myeloid leukemia (AML), four T cell acute lymphoblastic leukemia (T-ALL), and two primary T-ALL with secondary AML associated with a dominant clone with vector integration at the LMO2 (six T-ALL), MDS1 (two AML), or MN1 (one AML) locus]. Cytogenetic analysis revealed additional genetic alterations such as chromosomal translocations. This study shows that hematopoietic stem cell GT for WAS is feasible and effective, but the use of γ-retroviral vectors is associated with a substantial risk of leukemogenesis.

INTRODUCTION

Wiskott-Aldrich syndrome (WAS) is an X-linked, complex primary immunodeficiency disorder caused by mutations in the WAS gene (1) characterized by recurrent infections, thrombocytopenia, eczema, autoimmunity, and an increased risk of lymphoma (2, 3). The WAS protein (WASP) is a key regulator of actin polymerization in hematopoietic cells (4). The complex biology of this disease results from dysfunction in different leukocyte subsets, including defective T and B cell function, disturbed formation of the natural killer (NK) cell immunological synapse, and impaired migratory responses of all leukocyte subsets (46). Severe WAS leads to early death because of infections, hemorrhage, or malignancy (7, 8). For these patients, the standard curative therapy consists of allogeneic hematopoietic stem cell transplantation (HSCT). Although effective, allogeneic HSCT is associated with considerable morbidity and mortality, in particular if no human leukocyte antigen (HLA)–matched HSC donor is available (9).

HSC gene therapy (GT) has emerged as an alternative therapeutic strategy for primary immunodeficiency diseases [reviewed in (10, 11)]. Studies in patients with X-linked severe combined immunodeficiency disease [γc-SCID (1214)], adenosine deaminase (ADA)–deficient SCID (15, 16), and chronic granulomatous disease (CGD) (17) have demonstrated clinical benefits and at least temporary functional correction of immune cells. However, the occurrence of vector-associated clonal genotoxicity or gene silencing has raised concerns about long-term safety and efficacy (1823). We previously reported the initial results in the first two WAS patients treated in 2006 (24). Here, we provide a comprehensive clinical and molecular analysis of 10 patients treated by transplantation of autologous gene-modified HSCs.

RESULTS

Transplantation of autologous, gene-modified hematopoietic progenitor cells

Between 2006 and 2009, 10 patients with severe WAS were treated using HSC GT. Details of the protocol have been described previously (24). Peripheral blood mononuclear cells were harvested by leukapheresis upon treatment with recombinant human granulocyte colony-stimulating factor (rhG-CSF) alone (WAS1 and WAS2) or rhG-CSF in combination with the CXCR4 inhibitor plerixafor (WAS3 to WAS10). Patients were conditioned with busulfan (table S1) and received between 2.9 × 106 and 24.9 × 106 CD34-positive cells per kilogram of body weight, with a median transduction efficacy of 47.7% (see Table 1 and table S2 for further details). A comparison of transplantation details to the Paris SCID-X1 trial can be found in table S3.

Table 1. Clinical characteristics and treatment modalities of the study patients.

AIHA, autoimmune hemolytic anemia; BCG, Bacille de Calmette et Guérin.

View this table:

Reconstitution of WASP expression in PB cells after GT

After GT, we observed a strong increase in the proportion of WASP-corrected lymphoid cells over time in all patients (Fig. 1 and figs. S1 and S2), corresponding to a known proliferative advantage of WASP-positive lymphoid cells over their WASP-negative counterparts (25). Furthermore, there was evidence for sustained levels of correction in myeloid cells (Fig. 1). Patients treated with a mobilization regimen consisting of rhG-CSF and plerixafor (n = 8) tended to have superior myeloid cell engraftment in comparison to those patients who received only G-CSF (n = 2) (fig. S3 and table S4 for statistical analysis). In WAS3, who had received the lowest number (2.9 × 106) of CD34-positive cells per kilogram of body weight, we observed correction in up to 46% of lymphoid cells (day 264 after GT) but less than 2% corrected myeloid or CD34-positive cells.

Fig. 1.

(A to F) Expression of WASP in different leukocyte subpopulations and in platelets after GT. WASP expression in different leukocyte subpopulations was determined by flow cytometry before and after GT for patients WAS1 to WAS10 in (A) helper T cells (CD3+CD4+), (B) cytotoxic T cells (CD3+CD8+), (C) B cells (CD19+), (D) NK cells (CD3CD56+), (E) monocytes, and (F) thrombocytes. Day 0 indicates the date of reinfusion of gene-transduced cells.

Reconstitution of WASP expression in platelets and correction of microthrombocytopenia

With the exception of WAS3, all patients had a significant overall increase in platelet counts after GT (Fig. 2A), associated with reconstituted WASP expression (Fig. 1F and fig. S4). As expected, the size of platelets was increased after GT (Fig. 2B). The sustained correction of platelet function was associated with a cessation of the bleeding diathesis characteristic of WAS.

Fig. 2. Reconstitution of platelets, leukocyte function, and colitis after GT.

(A) Platelet counts were assessed before GT, at 12 months after GT, and at 24 and 36 months after GT. Wilcoxon matched-pairs signed rank test was used to assess significance levels. (B) Platelet size was determined in peripheral blood (PB) smears by light microscopy. Two healthy donors (HD1 and HD2), two untreated WAS (u.W.) patients (WAS1 and WAS2), one untreated patient suffering from pyruvate kinase deficiency (Pyr), and patients WAS1 to WAS10 after GT are shown. Splenectomized (S) patients were compared to the splenectomized control, whereas nonsplenectomized patients were compared to the nonsplenectomized control. Mann-Whitney test was used to assess significance levels. Significance levels were <0.001 for all analyzed populations but WAS8 versus splenectomized controls (P = 0.13). (C) Statistical analysis of NKIS formation estimated by confocal microscopy for healthy donors (HD, n = 8), for WAS patients before GT (n = 8), and for WAS patients after GT (n = 8). (D) PB IgE levels are shown at different time points after GT. (E) Colonoscopy pictures of patient WAS9 before and after GT (arrows indicate areas of inflammation). (F to K) Perturbation of TCR length distributions was estimated for patients WAS1 and WAS2 and subsequently compared to a healthy donor. DM scores representing the amount of perturbation were calculated [(F) for WAS1 and (I) for WAS2; normality of distribution D’Agostino-Pearson omnibus normality tests; level of significance was assessed by Student’s t tests]. Landscape surface plots indicate perturbation [(G) for WAS1 before GT, (H) for WAS1 4.5 years after GT, (J) for WAS2 before GT, and (K) for WAS2 4 years after GT].

Reconstitution of lymphocyte function

We measured lymphocyte number and function in each patient after GT. Before therapy, all patients except WAS4 and WAS6 required regular substitution with intravenous immunoglobulins (IVIgs). By contrast, at 12 to 14 months after GT, IVIg substitution could be discontinued in WAS2, WAS5, WAS8, and WAS9 with IgG levels maintained within a normal range (fig. S5). After IVIg substitution was discontinued and patients were vaccinated against tetanus and diphtheria, protective serum antibody titers to these antigens could be determined in patients WAS2, WAS4, WAS5, and WAS9, whereas in patients WAS7 and WAS10, specific antibodies could not be measured because of continuation of IVIg substitution therapy (fig. S6).

In line with a high level of correction in T lymphocytes (Fig. 1), we observed normalized T cell proliferative responses after GT (fig. S7 and table S5). WAS deficiency is associated with a skewed T cell receptor (TCR) Vβ repertoire (26). We analyzed TCR length distributions before and after GT and measured the amount of perturbation when compared to a typical healthy donor. We found that most patients with a highly disturbed TCR profile before GT significantly improved after GT, indicating a more polyclonal pattern of TCR Vβ usage (Fig. 2, F to K, and figs. S8 and S9). The cytoskeletal abnormalities in WASP deficiency are associated with defective formation of the NK cell immunological synapse (NKIS) (27, 28) and NK cell cytotoxicity (28). After GT, we observed a chimerism of WASP-positive and WASP-negative NK cells in all patients. The fraction of mature NKIS in the subset of WASP-positive cells after GT was comparable to healthy donor NKIS, whereas no improvement of the ability to form mature NKIS was noted for WASP-negative cells (Fig. 2C and fig. S10). Correction of the NKIS was also associated with an improvement of NK cell cytotoxicity after GT (fig. S11).

Clinical course

The average follow-up of 10 WAS patients was 47.4 months (range 15 to 81 months). As summarized in Table 1, patients showed various autoimmune phenomena before GT, including autoimmune cytopenias (WAS1 to WAS3 and WAS7), colitis (WAS2, WAS3, WAS5, and WAS7 to WAS10; Fig. 2E), and eczema (all patients). Clinical signs of autoimmunity resolved partially or completely in all patients except WAS3, accompanied by a reduction of serum IgE levels (Fig. 2D and table S6) in all patients except WAS3.

Hemorrhagic diathesis was present in all patients before GT. Within 1 year after GT, no relevant episodes of hemorrhage were observed in any of the patients, in line with the correction of platelet counts and WASP expression in platelets (Fig. 2, A and B, and table S7).

Infections before GT were frequent and severe, including bacterial sepsis, cellulitis, deep tissue abscesses, osteomyelitis, and pneumonias (Table 1). After GT, no severe infectious complications were observed in the patients with high levels of WAS correction, with the exception of one episode of pneumococcal meningitis in splenectomized patient WAS1 (24). One patient (WAS3) had no engraftment of WASP-positive HSC and continued to experience life-threatening bacterial infections and autoimmune hemolytic anemia. He underwent haploidentical bone marrow (BM) and matched chord blood transplantation 1 year after GT. WAS10 continued to have rare episodes of cellulitis and vasculitis, but both occurred with a lower intensity after GT. Together, these observations indicate that correction of WASP expression and leukocyte function was associated with improvement in clinical status, which was also reflected by an improvement of the WAS score (29) (table S8).

Clonality and insertion site analysis

To analyze the clonal dynamics of hematopoietic repopulation and to assess biosafety of the used vector, we performed standard and nonrestrictive (nr) linear amplification–mediated polymerase chain reaction (LAM-PCR) high-throughput sequencing of PB and BM samples, yielding 144,611 unambiguous integration sites (ISs) that mapped to a definite position in the human genome (patient WAS3: 923; all other patients: 8261 to 23,085; Fig. 3A, lower part). We observed a highly polyclonal and dynamic repopulation of the hematopoietic system in all patients up to 5 years after GT, except for WAS2 and WAS9 who showed a slow decrease of the clonality starting 2 years after GT (Fig. 3A, upper part, and fig. S12). In all patients, a typical γ-retroviral IS pattern could be observed with favored integrations into gene-coding regions and an accumulation around the transcription start site (TSS; fig. S13).

Fig. 3. Comprehensive IS analysis of all patients up to 5 years after GT.

(A) Total number of detected unique ISs after GT (lower panel) and the 10 most prominent clones (upper panel) for patients WAS1 to WAS10. Dark red indicates the strongest clone, purple indicates the 10th strongest one, whereas gray depicts all other ISs. Time points corresponding to diagnosis of ALL (WAS1 and WAS5 to WAS8) as well as AML (WAS9) and time points after start of chemotherapy for patients WAS1 and WAS5 to WAS8 are not included. See the Supplementary Materials for detailed information. (B) The table shows the most favored gene loci in which a high clustering of ISs (CISs) occurred at least in four patients (2 to 249 ISs). For this analysis, the 20 highest-order CISs of each patient were compared between patients. Dark blue indicates that the respective CIS was detected within the 20 highest-order ones, light blue indicates that the CIS was not detected within the 20 highest-order ones, and gray indicates that the CIS could not be detected within or close to this locus. The number of ISs involved in CIS is indicated in brackets. The star indicates that beside the described gene, other genes were involved in the CIS formation in some of the patients. (C to G) The localization of the CIS is shown for MDS1 (C), EVI1 (D), PRDM16 (E), LMO2 (F), and CCND2 (G). From bottom (dark red) to the top (purple), WAS1 to WAS10 are depicted. Every triangle represents one IS. The dominant LMO2 and MDS1 clones are marked with an arrow. Filled triangle, − orientation; empty triangle, + orientation; Up, upstream; Down, downstream.

Comparative analysis of common integration sites (CISs) between all patients revealed a marked high-level and similar clustering in identical genomic regions (Fig. 3B). Seventeen of the 25 most affected genes have previously been described as proto-oncogenes (30) (http://www.sanger.ac.uk/genetics/CGP/Census; http://variation.osu.edu/rtcgd/), and the four most frequently targeted gene loci (MDS1-EVI1, PRDM16, LMO2, and CCND2) have been observed in clonal expansions during other GT trials (17, 20, 21, 31). A more detailed analysis of the respective CIS locations revealed a concentration in specific subgene regions similar in all patients (Fig. 3, C to G). The accumulation affects intragenic regions for MDS1 (intron 2) and PRDM16 (introns 1 and 2) as well as regions upstream and around the TSS for the EVI1, LMO2, and CCND2 loci. Surprisingly, these subgene regions comprise only 100 to 300 kb.

Integrations within or close to the known proto-oncogenes MDS1-EVI1, PRDM16, LMO2, and CCND2 were detected for all nine successfully treated patients (Fig. 3, B to G, and fig. S14, A to D). Analysis of the retrieval frequency of all ISs within or close to these highly targeted genes revealed an overall low contribution, except at the leukemic time points (see next paragraph) (fig. S14, A to D). The analysis of sorted fractions allowed the detection of MDS1-EVI1 and LMO2 integrations in lymphoid (CD3+ cells) as well as myeloid fractions (neutrophils). Nevertheless, as previously observed for WAS1 and WAS2 (24), this analysis confirmed the tendency that MDS1-EVI1 integrations mainly occur in the myeloid compartment, whereas LMO2 integrations predominantly occur in the lymphoid compartment (fig. S15).

We further assessed the diversity over time for each patient by using the Shannon index (SA) (32) and the Simpson index (SI) (33) (fig. S16). The SA describes how many different integration clones are present at any given time point, whereas the SI gives information if the present clones show an equal contribution to gene-corrected hematopoiesis or if there is a marked disparity. The higher the value for both indices, the more different clones contribute equally to hematopoiesis. By calculating these indices, three different situations can be detected: A high SA as well as a high SI indicates a polyclonal situation, thus many different integration clones and no clonal dominance. A high SA but a low SI indicates many different integration clones, but there is a disparity in the contribution of those clones, and clonal dominance can be detected. A low SA as well as a low SI indicates an oligo- to monoclonal situation with just a few integration clones, and clonal dominance like it is observed for leukemic samples. The analysis confirmed a diverse hematopoietic regeneration for most of the analyzed patient samples, indicated by index values above the threshold. For WAS1, WAS5 to WAS8, and WAS9, a polyclonal condition was observed until malignant transformation [see next paragraph; WAS10 T cell acute lymphoblastic leukemia (T-ALL) is not included so far]. WAS2 shows, except for the last time point, an SA above the threshold but an SI below the threshold. This is in line with the nr/LAM-PCR results, where we detected many different integration clones, but one MDS1 clone showing an increasing contribution (fig. S12B).

Furthermore, ingenuity pathway analysis (IPA) revealed a significant enrichment (P ≤ 0.006, calculation including Bonferroni-Holm multiple testing correction) of ISs within or close to genes involved in the regulation of biological and immunological processes (for example, cell growth, cell cycle, and cell-mediated immune response), genes involved in hematopoiesis, as well as in different canonical pathways such as cancer-associated pathways and immunological pathways (fig. S17).

Acute leukemia

Six patients developed T-ALL 488 days (WAS6), 792 days (WAS8), 1073 days (WAS5), 1105 days (WAS7), 1364 days (WAS10), and 1813 days (WAS1) after GT (Table 2). Patients presented with typical clinical signs and symptoms, such as fatigue, anemia, fever, petechiae, and/or lymph node enlargement. Analysis of stained PB and BM smears showed the presence of leukemic blasts (Fig. 4A) and antigen expression patterns characteristic of T-ALL (Fig. 4B). Cytogenetic aberrations (Fig. 4C and Table 2) in leukemic blasts were TCR translocations consistent with molecular gene fusions in four patients (WAS1: TCRB and TAL2; WAS6: TCRA/D and MYC-C; WAS7: TCRB and CCND2; WAS8: TCRA/D and CEBPB) and translocation t(1;8)(q31;q23) in WAS5 (Table 2).

Table 2. Clinical and molecular details of T-ALL and AML in WAS1 and WAS5 to WAS9.
View this table:
Fig. 4. T cell acute lymphoblastic leukemia.

(A) Leukemic blast morphology is shown after May-Grünwald-Giemsa staining and microscopy. (B) Flow-based immunophenotypic analysis of leukemic blasts in patients WAS6, WAS1, and WAS8. (C) Chromosomal aberrations as identified using R-banding analysis and M-FISH in leukemic blasts. (D) Contribution of the dominant clone to the gene-corrected hematopoiesis. The leukemic clone is indicated in color (from red to blue), whereas all other ISs are depicted in gray. The affected genes from bottom-up are as follows: WAS1: MRPS28, LMO2, and IQSEC2; WAS5: C11orf74, TMEM217, LMO2, UBB, TAL1, ST8SIA6, CPSF6, CD46, and RIN3; WAS6: LMO2; WAS7: TAL1 and LMO2; WAS8: LMO2, CYTIP, IMMP2L, GSDMC, and TRMT1 (this IS is just 2.6 kb upstream of the proto-oncogene LYL1). d, days after GT.

Common to all six patients with T-ALL was the presence of retroviral vector integration within or close to the LMO2 gene locus (Fig. 4D and fig. S14E). Furthermore, we retrieved one to eight additional ISs within the leukemic clone (Fig. 4D, fig. S14E, and table S10). Notably, an integration upstream of TAL1 (for WAS5 and WAS7) and an integration just 2.6 kb upstream of LYL1 (for WAS8) (listed as IS within the gene TRMT1) were detected. Both genes are known proto-oncogenes that were already described in T-ALL formation (34). The leukemic clones had a rapid growth because at the most recent time point preceding leukemia (81 to 181 days before leukemia diagnosis), they were either not detectable or detectable with a low contribution of ≤5% (Fig. 4D and figs. S12, A, E to H, and J, and S14E). The comprehensive analysis of WAS10, the latest T-ALL case, is currently ongoing. IS data indicate a leukemic clone with multiple integrations, including one LMO2 and one LYL1 integration (fig. S12J). As for the other patients, development of the leukemia could not be predicted given by the monitoring, because the pattern was still markedly polyclonal 79 days before diagnosis (fig. S12J). Transcriptome analysis revealed an overexpression of LMO2 in four patients at the leukemic time point, suggesting that elevated expression levels of LMO2 may have triggered the development of T cell leukemia. Furthermore, aberrant expression of TAL1 could be observed for WAS5 and WAS7, whereas no signs of an overexpression of LYL1 were detected in WAS8 (fig. S18).

Viral copy numbers (VCNs) were assessed by quantitative PCR (qPCR) over time in lymphocytes and monocytes (fig. S19) without revealing clear trends for most patients with the exception of WAS8, who showed a strong increase of VCNs in the monocyte compartment over time. A comparison between VCNs in different PB cell compartments (CD3+, CD4+, CD8+, CD56+, CD14+, and CD19+), BM cells, and leukemic blasts indicated that the average VCN tended to be higher in leukemic samples than in healthy cellular subsets (fig. S20). VCN analysis by whole-genome sequencing resulted in very similar copy numbers for the T-ALL patients WAS1, WAS5, WAS6, WAS7, and WAS8 (table S10).

Tumor cells derived from WAS1, WAS6, and WAS8 T-ALL patients were transplantable into immunocompromised mice (see figs. S21 to S23). We demonstrated for WAS1 and WAS6 how the individual phenotype of human disease could be closely recapitulated in mice as demonstrated by flow cytometry analysis of cellular marker expression, disease progression over time, genomic vector integration tracking, and disease-typical leukemic organ infiltration including thymus enlargement.

All patients with T-ALL were treated with conventional chemotherapy according to the AIEOP-BFM ALL 2009 protocol (35), resulting in complete morphologic remissions upon therapy. Patients WAS6 and WAS7 received allogeneic SCT (table S9) and have remained free of disease since then. WAS5, who had an early leukemia relapse while on consolidation chemotherapy, achieved a second remission but succumbed to progressive leukemia on day +32 after allogeneic SCT. WAS1 and WAS8 remained in remission with respect to ALL for 30 and 16 months, respectively. Shortly after (in case of WAS1) or during (WAS8) maintenance therapy, both developed secondary acute myeloid leukemia (AML). Cytogenetic analysis of myeloid blasts revealed a t(9;17) translocation for WAS8.

The ongoing IS analysis after start of chemotherapy showed a clear reconstitution of a polyclonal pattern for WAS1, WAS6, and WAS7 associated with a strong decrease of the leukemic clone to <3% (fig. S24, A, C, and D). For WAS1, the clonality decreased again at the time point of AML diagnosis (day 2407 after chemotherapy) and a strong MN1 clone could be detected (fig. S24A). MN1 was already described to contribute during AML formation (36). WAS5 initially also showed a good response, leading to a strong decrease of the leukemic clone, but relapsed 122 days after start of chemotherapy with the same leukemic clone coming up again (fig. S24B). For WAS8, the leukemic clone decreased after start of chemotherapy, but the IS pattern stayed more oligoclonal with three ISs becoming stronger over time, including one MDS1 clone, finally leading to the development of secondary AML (day 1296 after chemotherapy) (fig. S24E). This patient had a relapse at day 1322 after chemotherapy associated with further increase of the contribution of the MDS1 clone and concomitant decrease of the clonality. At days 1296 and 1322 after chemotherapy, an integration pattern dominated by MDS1 insertions was detected (fig. S24E).

Patient WAS9 was diagnosed with AML 1165 days after GT. LAM-PCR identified a retroviral vector integration within the MDS1 gene locus (fig. S14E). In contrast to the rapid progression of the T-ALL cases, for WAS9, the same situation was observed as for WAS8 secondary AML—a slow increase of a MDS1 clone starting 596 days after GT with a contribution of ~1% and finally representing the strongest clone with ~25% at the time of leukemia diagnosis (fig. S12I). Calculation of the SA and the SI confirmed the slow regression of the clonality as the values dropped below the threshold at day 799 after GT (fig. S16). A steady increase in the contribution of the MDS1-EVI1 integrations could be observed starting at day 596 after GT in accordance with the increase of the MDS1 clone (fig. S14A). WAS9 was treated with chemotherapy according to COG AAML1031 (ClinicalTrials.gov identifier: NCT01371981), achieved remission, and engrafted 50 days after allogeneic SCT.

DISCUSSION

In 2009, clinical results of the first two patients with HSC therapy for WAS were reported (24). Here, we report a comprehensive and long-term survey on all 10 patients treated. Clinical signs and symptoms of WAS such as susceptibility to infections, autoimmunity, and bleeding can be reverted by transplantation of gene-corrected HSCs, provided that a sufficient level of sustained multilineage chimerism of WASP expression can be assured. We observed long-lasting functional correction of blood cell defects including reconstitution of T cell function, NK cell cytotoxicity, and differentiation of memory B cells, platelet size, and number, without any signs of loss of WAS transgene expression, as was observed in a recent CGD study because of vector methylation (31).

Patient WAS3, transplanted with only 2.9 × 106 CD34 cells per kilogram of body weight, had evidence of partial correction of lymphoid cells, but no WASP-positive myeloid or CD34 hematopoietic stem/progenitor cells were observed. This limited degree of chimerism was not sufficient to induce remission of immunodeficiency and autoimmunity. We think that the reason of failure does not rely on insufficient protein expression (in transduced peripheral T cells, WASP was expressed in physiological levels) but rather on a threshold effect related to numbers of transgenic progenitor cells transplanted. For subsequent collections of CD34 HSCs, we used a CXCR4 antagonist (plerixafor) (37) to further improve the yield of progenitor cells. Patient WAS10, aged 14 years at GT, experienced a slower immune reconstitution compared to the other patients. A similar phenomenon was observed in an adolescent γc-SCID patient treated within a clinical GT trial in London (38). Thus, HSC GT in adolescent patients may be associated with a slower and potentially inferior reconstitution of immunity, possibly due to thymus involution.

Several other groups are currently advancing preclinical GT studies for WAS into clinical trials, proposing a variety of diverse conditioning regimens. Using busulfan at a cumulative dose of 8 mg/kg, we observed sustained engraftment and correction of all relevant hematopoietic cells and very limited degrees of toxicities (transient BM suppression and partial alopecia). It will be interesting to see whether more intense conditioning regimens, associated with the risk of increased toxicity, may improve engraftment and outcome.

Furthermore, we report the most comprehensive IS analysis so far with an unprecedented number of >140,000 unambiguous ISs in our patients. The molecular follow-up of nine patients for 1.5 to 6 years after GT showed a polyclonal reconstitution of hematopoiesis for all patients at the beginning of GT. The analysis of the preferred gene loci revealed a marked similar clustering within the respective gene-coding regions shared between all patients. These hotspots were found within the proto-oncogenes already known from other GT trials where integration-driven overexpression led to the development of severe side effects such as leukemia and myelodysplasia (17, 1921, 31). Such high-precision clustering suggests that only in vivo clonal selection of the affected clones can account for this phenomenon. In previous studies, it has already been shown that higher clustering occurs in GT samples compared to pretransplant samples, supporting our hypothesis of an in vivo selection (3941). The high-level clustering of ISs not only within or close to the same gene loci but also into specific subgene regions comprising just up to 300 kb was a surprising finding. Why the clustering occurs in such a narrow window is yet not clear. Sequence motif comparison could not provide an explanation for this phenomenon. It is possible that the chromatin status or tethering factors directing the integrations to those specific regions might play a role (42). BET family proteins target murine leukemia virus integration to the TSS (43) and may be involved in strong clustering around transcriptional start sites of EVI1, LMO2, and CCND2. Similarly, the PRDM16 and MDS1 loci may comprise regulatory elements yielding susceptibility to retroviral integration and subsequent growth advantage.

Six patients (WAS1, WAS5, WAS6, WAS7, WAS8, and WAS10) developed T-ALL between 16 months and 5 years after GT. In all cases, IS analysis showed the involvement of a dominant LMO2 clone in leukemogenesis. Insertional mutagenesis involving the LMO2 locus induced a similar type of T-ALL in the γc-SCID GT trials (22), raising questions on the influence of the disease background and the constitutive expression of the common γ chain for leukemogenesis (20, 21, 44, 45). Our data now indicate that LMO2-driven leukemogenesis is not specific for γc-SCID GT (with 5 cases among 20 patients) but is also seen in WAS GT (7 of 10 patients). Furthermore, other factors such as the disease background and vector configuration might play a role. The relatively high vector copy number per cell (1.7 to 5.2), chosen on the basis of preclinical studies determining the threshold of WASP expression needed for correction of the cellular phenotype (46), may have contributed to an increased risk of insertional mutagenesis.

In contrast to the first five patients in the Paris γc-SCID trial (19, 45), the dominant LMO2 clone was not increasing slowly and steadily over time in our patients but appeared rather suddenly within 3 to 6 months (time course data resolution depends on the dates of routine follow-up visits). The different pattern in the γc-SCID studies might be explained by a preleukemic expansion in the thymic niche, with major release into the circulation only occurring after acquisition of secondary mutations. One patient developed primary AML, and two patients developed secondary AML. For two of these three patients, a dominant clone harboring an insertion site within the MDS1 gene triggered the development of myeloid leukemia. For the third patient, a strong MN1 clone could be detected. MN1 is a known player in AML formation (36). In contrast to the T-ALL cases, the contribution of the MDS1 clones increased slowly and steadily over time, whereas the LMO2 clones associated with T-ALL suddenly increased to >60%. A similar course of progressive MDS1 dominance could be observed in an X-CGD clinical trial where both treated patients developed myelodysplastic syndrome (MDS) associated with a steady increase of MDS1 clones, leading to the overexpression of the short transcript EVI1 (17). A similar pattern of MDS1 enrichment over time can be seen in patient WAS2.

The rate of morbidity/mortality cannot be exactly compared to that of allo-HSCT because of the single-armed nature of this study and the small sample size. However, although acute morbidity may be somewhat similar, it is obvious that autologous stem cell GT will lack detrimental allo-immune responses; on the other hand, the rate of secondary malignancy was unacceptably high in this study.

A clear limitation of this study lies in the small and unblinded patient collective that, for example, makes it hard to judge if the addition of plerixafor before leukapheresis is superior to G-CSF alone. Another limitation might be the lack of comparability to other clinical GT trials due to differences in multiple features like underlying disease, method of CD34+ collection, infection titers, viral pseudotype, and transduction protocol. Although relatively high vector copy numbers per cell and strong enhancer/promoter elements are very likely associated with high protein expression and therapeutic efficiency, they probably also increase the risk for genotoxicity and leukemogenesis. Future studies will need to determine whether improved vector designs, lower vector copy numbers, and targeted integration vector systems are associated with a lower risk of genotoxicity while preserving therapeutic efficacy. A recent study suggests that lentiviral vectors may also be used to revert the phenotype of WAS deficiency (42), but long-term observations are still pending.

In summary, we have demonstrated the feasibility and sustained efficacy of HSC GT for the treatment of WAS.

MATERIALS AND METHODS

Trial design and outcome measures

Ten patients (WAS1 to WAS10) with molecularly diagnosed WAS were included in this single-center prospective phase 1/2 pilot trial. Neither randomization nor blinding could be performed. This trial is now closed to accrual.

Vector generation and transduction of CD34+ cells

The retroviral vector CMMP-WASP used in this trial was previously described (46, 47). GALV-pseudotyped retroviral particles were produced under Good Manufacturing Practice (GMP) conditions as described previously (24). CD34+ cells were harvested by leukapheresis after stimulation with G-CSF. Details of the purification, stimulation, and transduction have been described in detail previously. Patients were treated with G-CSF (5 μg/kg per day) starting 2 days before leukapheresis. In some patients in whom mobilization using G-CSF exclusively was insufficient, additional AMD3100/plerixafor (0.25 mg/kg per day, one dose) was used to achieve mobilization of higher numbers of CD34+ cells.

qPCR analysis for VCN analysis

The presence of CMMP-WASP proviral sequences in the genomic DNA isolated from patient cells was determined with the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems) as described previously (24).

Reverse transcription PCR analysis for determination of gene expression levels

Complementary DNA (cDNA) synthesis was performed with the Verso cDNA Kit from Thermo Scientific as described by the manufacturer. cDNA (100 ng) was used to perform reverse transcription PCR for the genes LMO2, TAL1, and LYL1. The following PCR program was used for the amplification: initial denaturation for 120 s at 95°C; 36 cycles at 95°C for 45 s, 54°C for 45 s, and 72°C for 60 s; final elongation 300 s at 72°C. The primer sequences were as follows. LMO2: Forward 5′-GGCTTTGCTATTCACAAGGG-3′; Reverse 5′-CTCTCTCGGGAAGGTCTATT-3′. TAL1: Forward 5′-GAGCCGGATGCCTTCCCTAT-3′; Reverse 5′-GGTCATTGAGCAGCTTGGCC-3′. LYL1: Forward 5′-AGCATCTTCCCTAGCAGCCG-3′; Reverse 5′-CGCACCAGGAAGCCGATGTA-3′. Actin: Forward 5′-TCCTGTGGCATCCACGAAACT-3′; Reverse 5′-GAAGCATTTGCGGTGGACGAT-3′. The PCR product sizes were within the expected size-ranges: LMO2: 315 bp; TAL1: 277 bp; LYL1: 248 bp; Actin: 315 bp.

Flow cytometric analysis of WASP expression

Flow cytometric analysis of WASP expression in peripheral blood mononuclear cells and thrombocytes was performed as described previously (24, 48). Data acquisition was performed with a FACSCanto flow cytometer, and data analysis was performed with FlowJo software version 9.0 for Macintosh (Tree Star Inc.).

Immunoblot analysis

Cytoplasmic protein from peripheral blood mononuclear cells or thrombocyte-rich plasma was extracted and separated by SDS–polyacrylamide gel electrophoresis and stained with an anti-WASP antibody (clone D-1) and anti–glyceraldehyde-3-phosphate dehydrogenase (both from Santa Cruz Biotechnology). After staining with horseradish peroxidase–conjugated goat anti-mouse antibody (BD Biosciences), blots were developed with Chemiluminescence Kit (Pierce), and images were captured on a ChemiDoc XRS Imaging System (Bio-Rad).

Sequencing of the WAS gene

Sequencing of the WAS gene in patients was performed as described previously (24, 48).

T cell proliferation assays

T cell proliferation assays were performed as described previously with minor modifications (24, 49). In brief, T cells were stimulated in CD3-coated (1 μg/ml) 96-well plates with or without additional human interleukin-2 at a final concentration of 10 IU/ml or with phytohemagglutinin (Sigma) at a concentration of 10 μg/ml or noncoated plates. Cells were stimulated for 48 hours, pulsed with 1 μCi (0.037 MBq) of [3H]thymidine (PerkinElmer) for 24 hours, and analyzed for [3H]thymidine incorporation.

Analysis of platelet size

PB smears of indicated days were air-dried and stained with Giemsa staining. Images were acquired with an Olympus CX31 microscope and Cell B Software version 3.2 (Olympus). Platelet sizes were estimated with ImageJ software (W. S. Rasband, U.S. National Institutes of Health; http://imagej.nih.gov/ij/).

Analysis of the NKIS

NK cells were negatively selected from PB with the Rosette Sep Human NK Cell Enrichment Cocktail (STEMCELL Technologies) and immediately used to prepare conjugates with K562 target cells. Conjugates were prepared as described before (27, 28). Briefly, NK and K562 cells were resuspended in RPMI, mixed, and incubated at 37°C for 15 min. After gentle resuspension, the conjugates were adhered to poly-l-lysine–coated microscope slides (Sigma) for 15 min at 37°C. The adherent cells were washed once in phosphate-buffered saline (PBS) and fixed and permeabilized with Fix & Perm (Invitrogen) solution A for 20 min at room temperature. All wash steps thereafter were performed in 1× BD Perm/Wash buffer. All antibodies were diluted in Invitrogen Fix & Perm solution B. Cells were stained for 40 min with anti-WASP (clone B9, Santa Cruz Biotechnology) and washed twice, followed by incubation with anti-mouse IgG–AF546 (Molecular Probes) for 1 hour. After two washes, the cells were incubated with anti-tubulin–biotin antibody (BD) for 1 hour. After two washes, the cells were incubated with streptavidin–Pacific blue (Invitrogen), perforin–fluorescein isothiocyanate (BD), and phalloidin-AF635 (Sigma). Adherent conjugates were washed, mounted with Gold Antifade (Invitrogen), and covered with glass coverslips. Images were acquired by confocal laser scanning microscopy on a Leica DM IRB (Leica Microsystems). Data visualization and analysis were performed with the Imaris software package (Bitplane AG). For three-dimensional reconstructions, 10 to 16 0.2-μm z-stacks were recorded and rendered with Imaris. Conjugates were identified as small perforin-containing cells (NK) touching large cells (K562). F-actin, WASP, and perforin were evaluated as nonsynaptic or having synaptic accumulation in about 50 conjugates randomly selected on each slide. A synapse was counted as mature/polarized if having synaptic accumulation and colocalization of perforin, actin, and the microtubule organizing center, respectively. Statistical significance was evaluated with Fisher’s exact test.

Analysis of NK cell cytotoxicity

Analysis of NK cell cytotoxicity was performed as described previously (24).

T cell CDR3 spectratyping

TCR Vβ spectratyping was performed according to the method of Pannetier et al. (50, 51) with minor modifications, as described previously (24).

Fluorescence-activated cell sorting staining of leukemic blasts

Fluorescence-activated cell sorting (FACS) staining of leukemic blasts was carried out according to the current European Group for the Classification of Acute Leukemia recommendations (52).

Chromosome banding analysis

We prepared metaphases of BM according to standard procedures after a short-term culture of 24 to 48 hours. Fluorescence R-banding with chromomycin A3 and methyl green was performed as described in detail earlier (53). Whenever possible, 25 metaphases were analyzed in each case. Karyotypes were described according to the International System for Human Cytogenetic Nomenclature (54).

Multicolor fluorescence in situ hybridization

Multicolor fluorescence in situ hybridization (M-FISH) analysis was carried out with an M-FISH kit (MetaSystems). The M-FISH procedure was performed according to the manufacturers’ instructions and as previously described (55). Fluorochromes were sequentially captured with specific single-band pass filters in a Zeiss Axioplan 2 microscope. mFISH Isis software (MetaSystems) was used for image analysis. At least five metaphases were analyzed.

Array comparative genomic hybridization

High-resolution array comparative genomic hybridization (aCGH) by means of oligo arrays (400K, Agilent Technologies) was performed following the manufacturer’s instructions (Oligonucleotide Array-Based CGH for Genomic DNA Analysis v. 4.0). The direct labeling protocol was used with 1 μg of DNA as starting material. Scanning was done with Agilent scanner G2505C at a resolution of 2 μm. Images were analyzed with Feature Extraction Software (Agilent Technologies) with the standard protocol, and data processing was performed with DNA-Workbench (Agilent Technologies). The median probe density of this array was 5.3 kb (4.6 in RefSeq genes), and the resolution under the given filter settings (at least five probes with mean log ratio = 0.4) was about 25 kb. Localizations referred to the genome assembly (February 2009, GRCh37/hg19).

nrLAM-PCR IS analyses, high-throughput sequencing, and bioinformatical data mining

LAM-PCR or nrLAM-PCR starting from either the 5′ or 3′ long terminal repeat (LTR) was done as previously described (56, 57). In brief, 100 to 1000 ng of DNA derived from PB, BM, or fractions (CD3+ cells and neutrophils) were used for the linear amplification of the vector-genome junctions. After enrichment of the amplified fragments via magnetic beads, the second DNA strand was generated and the fragments were digested with a restriction enzyme (Tsp 509I, Mse I, Nla III, Hin PI, or Hpy CH4IV) during LAM-PCR, whereas nrLAM-PCR circumvents double-strand synthesis and restriction digest. After ligation of a known single-stranded (nrLAM-PCR) or double-stranded (LAM-PCR) oligonucleotide to the unknown part of the amplicons, two nested exponential PCRs were performed. The further preparation of the samples for high-throughput sequencing (454 pyrosequencing and MiSeq sequencing) comprised another exponential PCR to add the specific amplification and sequencing adapters to both ends of the amplicons (56). To allow the parallel sequencing of different samples, we used a 6– to 10–base pair (bp) barcode. DNA (40 to 50 ng) was amplified using the following PCR program: initial denaturation for 120 s at 95°C; 12 to 15 cycles at 95°C for 45 s, 58°C for 45 s, and 72°C for 60 s; final elongation 300 s at 72°C. To facilitate removal of contaminations between samples, for later sequencing runs, we introduced the use of an oligonucleotide with a 12-bp barcode during ligation. Raw LAM-PCR amplicon sequences were separated according to the introduced barcode or barcode combination, further trimmed, and aligned to the human genome sequence with BLAT (58) (Assembly February 2009).

For the analysis of the CIS, the following definition was used: 2 ISs within 30 kb form a CIS of second order, 3 ISs within 50 kb form a CIS of third order, 4 ISs within 100 kb form a CIS of fourth order, 5 to 50 ISs within 200 kb form a CIS of fifth or higher order, and >50 ISs within 300 kb form a CIS of >50th order (59).

IPA (http://www.ingenuity.com/) allowed analyzing our data set with respect to molecular functions of genes hit by ISs. To calculate the P values, we used Bonferroni-Holm multiple testing correction.

For the analysis of diversity, the SA and SI were used (32, 33). Both analytical indices take the two components into account, which compose the diversity concept. Those two components are the richness of populations and the homogeneity. The first component, the richness of populations, is defined by the total number of species (integration sites = ISs). The second component, the homogeneity, measures the distribution of the individuals in the population (concept of dominance). The SA is more focused on the richness of the population and is calculated as follows: Embedded Image The SI is more focused on the homogeneity/concept of dominance and is calculated as follows: Embedded Image, where s is the number of species (ISs), ni is the number of sequencing reads in species i, and N is the total number of reads. According to those two indices, the following situations can occur: SA and SI above threshold indicate that a sample is polyclonal and no dominant clones are present. SA above threshold and SI below threshold mean that the sample is still polyclonal, but some stronger clones emerge. SA and SI below the threshold reveal that the sample is oligo- to monoclonal.

Xenotransplantation of leukemic cells

NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ (Il2rg−/−) mice were obtained from The Jackson Laboratory and housed at specific pathogen–free animal facilities according to all applicable laws and regulations following approval by the institutional animal care and ethical committees (German Cancer Research Center and Hannover Medical School). Mononuclear cells (MNCs) from PB or BM of patients WAS1, WAS6, and WAS8 were separated by Ficoll-Hypaque (PAA Laboratories) density gradient centrifugation. For xenotransplantation, isolated MNCs were injected either intravenously or intrafemorally or were transplanted under the kidney capsule (ikc) of immunodeficient mice.

For intravenous transplantation, 1 × 107 to 8 × 107 leukemic cells were resuspended in Hanks’ balanced salt solution (HBSS) plus 2% fetal bovine serum (FBS) (HF, STEMCELL Technologies), and a total volume of 125 to 300 μl per mouse was injected into the tail vein. For intrafemoral injection, mice were narcotized with 1.7% isoflurane, a 27-gauge needle was inserted into the joint surface of the right tibia, and 30 μl of cell suspension containing a total of 7.7 × 106 to 1.26 × 107 cells was injected into the mouse BM cavity. For ikc transplantation, 4 × 106 cells were resuspended in 10 to 30 μl of PBS, mixed 1:1 with Matrigel (BD Biosciences), and injected under the kidney capsule of 8- to 12-week-old Il2rg−/− mice. For serial transplantation, leukemic cells were harvested from PB and BM of primary recipients, washed, and resuspended in HF, and intravenous, intrafemoral, and ikc transplantations of 4 × 105 to 2 × 107 were done as described.

Analysis of human engraftment in xenotransplanted mice

At different time points after xenotransplantation, 200 μl of PB was collected by puncture of the vena saphena. Erythrocytes were lysed twice with lysis buffer containing 0.15 M ammonium chloride, 10 mM potassium hydrogen carbonate, and 0.1 mM disodium-EDTA, and the cells were washed in HBSS (Sigma-Aldrich) containing 2% FBS. Cells were stained with antibodies (all from BD) against human CD45 and CD71 together with CD3 and CD7 (WAS6) or with CD7, CD4, and CD8 (WAS1 and WAS8) and analyzed on an LSRII FACS analyzer (BD) with BD FACSDiva 6.1.3 software. For comprehensive characterization of mouse PB cells in three primary mice transplanted with cells of patient WAS6, blood samples were taken by retro-orbital bleeding and analyzed with the scil vet abc blood counter (scil animal care company GmbH) or by flow cytometry (as described earlier). Erythrocyte lysis was performed on blood and spleen samples before antibody staining. Staining was carried out in PBS containing 2% fetal calf serum and 2 mM EDTA for ~45 min. All stainings were in combination with anti-human CD45. Flow cytometric analysis was carried out with the FACSCalibur (BD) or the LSRII (BD). FlowJo software version 9.0 for Macintosh (Tree Star Inc.) was later used for detailed analysis of FACS data. Human CD45 cells were selected among the total nucleated cells, and then the percentages of the indicated markers were determined.

For patients WAS1 and WAS6, IS-specific vector-genome junctions were amplified by PCR of 20 ng of DNA isolated from PB of xenotransplanted mice. Nested PCRs were performed to amplify clone-specific LMO2-vector junction sequences from xenografted cells. First and second primer pairs contained one primer binding in the vector-LTR and one primer binding in the specific adjacent genomic sequence. Second primer pairs bound in the amplified region of the first pair. Primer sequences were as follows: WAS1 first PCR, LMO2-CCACTCACTTAATCAACCTT and Vector-TCCGATAGACTGCGTCGC; WAS1 second PCR, LMO2-GATCATCAACAAACGTGGTT and Vector-TCTTGCAGTTGCATCCGACT; WAS6 first PCR, CTGATGCATCAGCACACCTG and Vector-TCCGATAGACTGCGTCGC; WAS6 second PCR, LMO2-CTGATGCATCAGCACACCTG and Vector-GGTACCCGTATTCCCAATA. PCR conditions were as follows: 35 cycles at 95°C for 60 s, annealing at 58°C for 60 s, and elongation at 72°C for 60 s.

Statistical analysis

Statistical analysis was performed with GraphPad Prism 6 for Mac and Microsoft Excel 2011 for Mac. The statistical tests used are mentioned in figure legends. In general, normality was accessed with D’Agostino-Pearson omnibus normality test. Normally distributed samples were then further analyzed with paired or unpaired t tests. If samples were not normally distributed or normal distribution could not be accessed because of small numbers, the levels of significance were calculated by Mann-Whitney tests. Bonferroni-Holm multiple testing correction was used to calculate significance levels of IPA.

Ethics statement

The clinical GT protocol was reviewed and approved by the Ethics Committees of Hannover Medical School and Ludwig Maximilian University Munich. All procedures were done following the Declaration of Helsinki Guidelines and under the strict observation of the German regulatory authority for biologics/cell therapies (Paul Ehrlich Institute). The trial is registered under DRKS00000330 at German Clinical Trials Register.

Data and materials availability

The IS data are provided as a supplementary excel table.

SUPPLEMENTARY MATERIALS

www.sciencetranslationalmedicine.org/cgi/content/full/6/227/227ra33/DC1

Fig. S1. WASP expression analysis in peripheral blood mononuclear cells in patients WAS1 to WAS10 before GT.

Fig. S2. WASP expression analysis in peripheral blood mononuclear cells in patients WAS1 to WAS10.

Fig. S3. Influence of G-CSF versus plerixafor mobilization on long-term WASP expression in leukocyte subsets.

Fig. S4. WASP expression analysis in platelets in patients WAS1 to WAS10.

Fig. S5. Immunoglobulin levels after GT.

Fig. S6. Diphtheria and tetanus vaccination response after GT.

Fig. S7. T cell proliferation analysis after GT.

Fig. S8. TCR Vβ spectratyping before and after GT.

Fig. S9. Statistical analysis of TCR Vβ spectratyping before and after GT.

Fig. S10. Immunological synapse formation after GT.

Fig. S11. NK cell lytic activity.

Fig. S12. Contribution of single ISs in WAS GT.

Fig. S13. Analysis of the IS distribution in the WAS study.

Fig. S14. Time course of abundance of detected insertion sites affecting already known proto-oncogenes and contribution of the leukemic clones.

Fig. S15. Analysis of lymphoid (CD3+ cells) and myeloid (neutrophils) samples regarding LMO2 and MDS1-EVI1 integrations.

Fig. S16. Clonality analysis to determine the heterogeneity of hematopoietic regeneration after GT by SA and SI.

Fig. S17. Ingenuity pathway analysis.

Fig. S18. Transcription analysis for the proto-oncogenes LMO2, TAL1, and LYL1.

Fig. S19. Longitudinal VCN analysis for patients WAS1 to WAS10.

Fig. S20. VCNs at the latest follow-up.

Fig. S21. Engraftment of leukemic clones in immunodeficient mice for patients WAS1.

Fig. S22. Transplantation of tumor cells in immunodeficient mice for patient WAS6.

Fig. S23. Transplantation of tumor cells in immunodeficient mice for patient WAS8.

Fig. S24. Clonality analysis for patients WAS1 and WAS5 to WAS8 after start of chemotherapy.

Table S1. Details of busulfan conditioning regime per patient.

Table S2. Transplantation characteristics.

Table S3. Comparison of WAS-GT features with features of Paris SCID-X1 retroviral GT.

Table S4. Influence of G-CSF versus plerixafor mobilization on long-term WASP expression in monocytes.

Table S5. T cell proliferation data.

Table S6. IgE levels of patients after GT.

Table S7. Bleeding events before and after GT.

Table S8. WAS score before and after GT.

Table S9. Outcome of HSCT.

Table S10. Leukemic ISs for T-ALL and AML clones.

REFERENCES AND NOTES

  1. Acknowledgments: We thank the clinical staff taking care of the patients and acknowledge the expert administrative and technical assistance of M. Dorda, J. Diestelhorst, O. Jensen, M. Sass, R. Conca, and M. Tauscher. We thank C. Lulay for the great help in sample processing for IS analysis, and A. Arens for help in analyzing the sequencing data. We also acknowledge N. Howells and S. Hamzaoui-Nord for help in animal care, and S. Fessler, A. Mengering, and S. Wenzel for technical assistance. We thank the Hannover Clinical Trial Center team guided by H. von der Leyen for expert monitoring services. We wish to thank the patients and their families for their willingness to participate and dedicate this work to all children with WAS. Funding: Bundesministerium für Bildung und Forschung BMBF (http://www.bmbf.de), German PID-NET and grant 01GU0809 (iGene), and the European Commission’s 7th Framework Program (http://ec.europa.eu/research), contract HEALTH-FS-2009-222878-PERSIST. This study was further supported by the Deutsche Forschungsgemeinschaft (Gottfried-Wilhelm-Leibniz Program, SFB873), the Cluster of Excellence REBIRTH (From Regenerative Biology to Reconstructive Therapy), the Stefan-Morsch Foundation, and the Care-for-Rare Foundation. Author contributions: C.K. conceptualized and designed the study. S.N. and K.K. prepared the transplantation products according to GMPs. S.N., K.K., C.J.B., K.B., A.P., M.W., A. Schwarzer, M. Rothe, U.M., G.G., D.S., R. Fronza, C.R.B., R.H., A. Schambach, M.S., and C.v.K. performed the experiments. C.J.B., K.B., M.W., R.B., M. Rose, C.F., L.M., R. Ferrari, M.R.A., W.A.-H., I.K., L.M., M.H.A., and C.K. managed the patients clinically. All authors read, commented, and agreed to the final version of the manuscript. Competing interests: The authors declare that they have no competing interests.
View Abstract

Navigate This Article