Research ArticleALS

Targeting RNA Foci in iPSC-Derived Motor Neurons from ALS Patients with a C9ORF72 Repeat Expansion

See allHide authors and affiliations

Science Translational Medicine  23 Oct 2013:
Vol. 5, Issue 208, pp. 208ra149
DOI: 10.1126/scitranslmed.3007529

Abstract

Amyotrophic lateral sclerosis (ALS) is a severe neurodegenerative condition characterized by loss of motor neurons in the brain and spinal cord. Expansions of a hexanucleotide repeat (GGGGCC) in the noncoding region of the C9ORF72 gene are the most common cause of the familial form of ALS (C9-ALS), as well as frontotemporal lobar degeneration and other neurological diseases. How the repeat expansion causes disease remains unclear, with both loss of function (haploinsufficiency) and gain of function (either toxic RNA or protein products) proposed. We report a cellular model of C9-ALS with motor neurons differentiated from induced pluripotent stem cells (iPSCs) derived from ALS patients carrying the C9ORF72 repeat expansion. No significant loss of C9ORF72 expression was observed, and knockdown of the transcript was not toxic to cultured human motor neurons. Transcription of the repeat was increased, leading to accumulation of GGGGCC repeat–containing RNA foci selectively in C9-ALS iPSC-derived motor neurons. Repeat-containing RNA foci colocalized with hnRNPA1 and Pur-α, suggesting that they may be able to alter RNA metabolism. C9-ALS motor neurons showed altered expression of genes involved in membrane excitability including DPP6, and demonstrated a diminished capacity to fire continuous spikes upon depolarization compared to control motor neurons. Antisense oligonucleotides targeting the C9ORF72 transcript suppressed RNA foci formation and reversed gene expression alterations in C9-ALS motor neurons. These data show that patient-derived motor neurons can be used to delineate pathogenic events in ALS.

INTRODUCTION

Amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD) are neurodegenerative disorders that overlap in their clinical presentation, pathologic findings, and genetic origins (13). No treatments are currently available. ALS presents clinically as muscle wasting with stiffness and spasticity from loss of motor neurons in the spinal cord, whereas FTLD manifests most commonly with behavioral and language disturbances because of degeneration of regions of the frontal and temporal cortices (4). Both diseases commonly show accumulations of abnormal proteins including the DNA/RNA binding protein TDP-43 (5). Mutations in several genes cause both disorders, including TARDBP (which encodes TDP-43) and VCP, although these are responsible for very few cases (6, 7). Recently, expansions of a GGGGCC hexanucleotide repeat in the first intron/promoter of the C9ORF72 gene were reported to be the most commonly identified genetic cause of ALS and FTLD in both familial and sporadic cases in Caucasians (810). More recently, C9ORF72 repeat expansions were reported in other neurodegenerative diseases, including Alzheimer’s disease (11, 12) and Parkinson’s disease (13). The broad neurodegenerative phenotype and the high frequency of the mutations emphasize the need to develop treatments for C9ORF72 repeat expansion diseases.

A key remaining question is whether the repeat expansion in C9ORF72 leads to loss of function, gain of function, or both. Several lines of evidence suggest that the repeat expansion may suppress or alter the expression of the mutant allele. Decreased expression of C9ORF72 transcripts has been reported (8, 10), as has hypermethylation of the repeat-containing allele (14). Knockdown of the C9ORF72 orthologue in zebrafish resulted in motor deficits (15). However, early reports also indicated that the repeat is transcribed and leads to accumulation of repeat-containing RNA foci in patient tissues (8). Subsequently, it was found that simple peptides could be generated by repeat-associated non-ATG–dependent translation (16, 17). Both RNA foci and protein aggregates may produce a gain-of-function toxicity in neurons to promote neurodegeneration. Further supporting this gain of function is the fact that other mutations that would cause haploinsufficiency, such as early stop codons, have not been observed (18). A patient homozygous for the C9ORF72 repeat expansion had a phenotype similar to heterozygotes, rather than the more severe phenotype that would be expected for complete loss of function (19).

Here, we generated induced pluripotent stem cells (iPSCs) from patients with ALS caused by the C9ORF72 repeat expansion (C9-ALS) and differentiated them into motor neurons. Using a variety of methods, we observed that expression of C9ORF72 was not significantly decreased in human motor neuron cultures from C9-ALS patients. Knockdown of all C9ORF72 transcripts was not toxic to iPSC-derived motor neurons from normal control subjects. Antisense oligonucleotides (ASOs) targeting the C9ORF72 transcript suppressed gain-of-function manifestations, including formation of RNA foci, and corrected altered gene expression profiles.

RESULTS

Skin fibroblasts were reprogrammed from four different C9ORF72 hexanucleotide expansion carriers who had either ALS or ALS with FTLD (table S1). A nonintegrating system based on the oriP/EBNA1 (Epstein-Barr nuclear antigen 1)–based episomal plasmid vector system was used to avoid potential deleterious effects of random insertion of proviral sequences into the genome (2022). All iPSC lines expressed the pluripotency markers (SSEA4, TRA-1-81, OCT3/4, and SOX2) along with a normal karyotype (Fig. 1A). Pluripotency was further confirmed with PluriTest, a validated open-access bioinformatics pathway for assessing pluripotency using transcriptome profiling (23), alkaline phosphatase (marker of pluripotency), flow cytometry analysis of positive SSEA4 and OCT4+ marker expression, and spontaneous embryoid body differentiation assay to detect formation of the three germ layers (fig. S1). All iPSC lines lacked expression of exogenous transgenes with quantitative reverse transcription polymerase chain reaction (qRT-PCR) and genomic PCR analysis, demonstrating that the oriP/EBNA1 method generated “footprint-free” iPSC lines (fig. S2). C9-ALS and control patient iPSC lines were then differentiated into motor neurons and associated support cells according to established protocols (21) as also illustrated in the schematic in fig. S2C. Our differentiation protocol yielded OLIG2- and HB9-expressing motor neuron precursors (fig. S2D) and cultures composed of normal-appearing spinal motor neurons that were labeled with SMI32 and ChAT (Fig. 1B and fig. S3A). At 7 weeks of differentiation, all iPSC-derived motor neuron cultures consisted of SMI32+ motor neurons (33 to 45%) and TuJ1+ pan-neurons (58 to 75%), whereas the remaining cells (20 to 30%) were labeled with glial fibrillary acidic protein (GFAP) (astrocyte marker) and nestin (neural progenitor marker) (fig. S3B). Consistent with their acquisition of motor neuron markers reflecting in vitro maturation, patch-clamp recordings showed that motor neurons fired normal-appearing spontaneous and depolarization-induced action potentials (Fig. 1E).

Fig. 1. Generation of C9ORF72 ALS patient–derived iPSCs and motor neurons.

(A) Pluripotency marker expression in iPSC lines derived from four ALS patients with a C9ORF72 repeat expansion. Immunostaining shows expression of embryonic and pluripotency stem cell surface antigens (SSEA4, TRA-1-60, and TRA-1-81) and nuclear pluripotency markers (OCT3/4 and SOX2). Karyotypes of the four C9ORF72 patient iPSC lines are shown on the right. (B) Efficient production of motor neurons from ALS C9ORF72 patient–derived iPSCs demonstrated by SMI32+ and ChAT+ immunostaining. TuJ1 is a pan-neuronal marker used to assess total production of neurons. (C) Examination of hexanucleotide repeat lengths in fibroblasts, iPSCs, and motor neuron cultures by Southern blot analysis, showing somatic instability of the repeat with both expansion (iPSCs in lines 28i, 29i, and 52i) and contraction (motor neurons in iPSC line derived from patient 29). Passage numbers (p) for iPSCs are shown. (D) Motor neuron survival over time was not altered in the iPSC-derived motor neuron cultures derived from four individual C9ORF72 ALS (C9-ALS) patients versus four control subjects (n = 3 independent experiments) [one-way analysis of variance (ANOVA), Tukey’s multiple comparison test; control versus ALS; 95% confidence interval (CI) of difference, −12.8 to 24.15 (4 weeks) and −7.36 to 30.42 (7 weeks)]. Motor neuron counts are represented as a ratio of motor neuron (SMI32+) to pan-neuronal (TuJ1+) populations. (E) Properties of functional motor neurons were observed when iPSCs were differentiated into motor neurons (representative motor neuron from control iPSC line 83i is shown at day 69 of differentiation). Current injections of −10 and +5 pA (top left). Resting potential of the motor neuron was −60 mV with 2.6-gigohm input resistance. Spontaneous activity of the same motor neuron (top right). Representative images confirming motor neuron identity of recorded neurons (bottom panels). Neurons filled with Alexa Fluor 594 dye (red) during live electrophysiological recordings are shown after fixation and counterstained with motor neuron marker ChAT (green), confirming their identity. DAPI, 4′,6-diamidino-2-phenylindole.

To examine the stability of the GGGGCC repeat in C9-ALS patient motor neurons differentiated from iPSCs derived from patient fibroblasts, we performed Southern blot analysis (Fig. 1C). In three of the patient iPSC lines (28i, 29i, and 52i), Southern blotting showed that the expanded allele was 6 to 8 kb, or ~800 repeats. In two lines, there was a shift indicating somatic expansion of the repeat upon conversion of fibroblasts to iPSCs (29i and 52i), and line 29i showed a polymorphic contraction of the repeat upon differentiation into motor neurons (Fig. 1C). This may reflect the somatic variability observed across different patient brain regions (24), or may alternatively be due to clonal expansion of subclones with different-sized repeats. Line 30i showed only ~70 repeats, which was stable during reprogramming of fibroblasts to iPSCs. Despite the shorter repeat, this individual exhibited early-onset bulbar ALS with the shortest disease duration of the four patients, suggesting a sharp threshold for repeat length and disease. Additional genetic or environmental modifiers may have a strong influence on disease onset and severity (table S1).

We previously observed that motor neurons from patients with spinal muscular atrophy, a childhood-onset motor neuron disease, showed decreased survival in vitro (21, 25). Therefore, we examined motor neuron counts at two time points after differentiation but saw no difference in the development or survival of motor neurons between C9-ALS patients and controls (Fig. 1D). Because neuronal counts become technically challenging because of confluent growth with longer time in culture, we cannot rule out that a survival phenotype may have emerged with further in vitro maturation.

Early reports indicated that C9ORF72 gene expression is altered in patient tissue with decreased expression of either one (8) or all (10) isoforms. We first investigated expression from the C9ORF72 locus to examine the possibility of loss of function by performing RNA-sequencing (RNA-seq) analysis of C9-ALS and control fibroblasts and iPSC-derived motor neurons in culture. The normalized number of mapped sequence reads (RPKM) corresponding to all annotated exons of C9ORF72 was not different between C9-ALS patients and controls in either fibroblasts or motor neuron cultures, with ~15-fold higher expression seen in neurons than in fibroblasts (Fig. 2A). Similar results were obtained using qRT-PCR with primers to exon 2, common to all isoforms (Fig. 2B). Allele-specific analysis from RNA-seq data indicated that the wild-type and mutant alleles were expressed similarly, and transcript-specific analysis across two different annotation sets (Ensembl and RefSeq) did not reveal differences between C9-ALS patients and controls (fig. S4). Notably, sampling of exons 1a and 1b was relatively low in the RNA-seq reads possibly due to the high GC content and repetitive sequence in this region, so differential transcript analysis is driven primarily by exons 2 to 11. We further performed Western blot analysis of different cell fractions from iPSC-derived motor neuron cultures to investigate C9ORF72 protein levels. Commercially available C9ORF72 antibodies recognized isoforms 1 and 2 in whole-cell lysates from transfected cells, with bands corresponding to these isoforms present in the membrane fraction of iPSC-derived motor neurons (Fig. 2C). This is consistent with the idea that C9ORF72 is a member of the DENN family of Rab guanine nucleotide exchange factors involved in membrane trafficking (26, 27). We confirmed the specificity of these bands by knockdown of C9ORF72 using ASOs (see below) (fig. S5B). No difference in the level of C9ORF72 protein was observed in C9-ALS patient cells compared to controls (fig. S5A).

Fig. 2. The hexanucleotide expansion does not alter expression of C9ORF72 but alters upstream exon use to promote transcription of the repeats.

(A) Reads per kilobase per million mapped reads (RPKM) from RNA-seq of motor neurons differentiated from iPSCs derived from control individuals (n = 4 independent subjects) and ALS patients with the C9ORF72 repeat expansions (C9-ALS, n = 4 independent subjects) and fibroblasts for all annotated transcripts from the C9ORF72 gene. Overall expression of C9ORF72 transcripts was not different between controls and C9ORF72 expansion carriers, with motor neuron cultures showing higher RPKM values than fibroblasts. (B) qRT-PCR in iPSC-derived motor neuron cultures from four control subjects and four C9ORF72 expansion carriers using primers in exon 2 (common to all C9ORF72 transcript variants), confirming equivalent expression of the C9ORF72 gene. Data are represented as means ± SEM from n = 3 independent experiments. n.s., not significant using Student’s t test. (C) Western blot of C9ORF72 protein in cellular fractions from iPSC-derived motor neuron cultures showing two bands in the membrane fraction running slightly smaller than the sizes of overexpressed long and short isoforms because of the presence of a Flag tag on these constructs. Representative blots showing similar levels of protein were observed in control (83iCTR) and C9ORF72 expansion (28iC9-ALS) motor neuron cultures, indicating that the presence of the repeat did not alter overall protein levels. Data are representative of n = 3 independent experiments. (D) Representative sequence alignments of upstream exon sequences (exon 1a or 1b) from 5′RACE analysis of C9ORF72 transcripts in fibroblasts from a control subject (14iCTR). Stacked horizontal bars represent individual transcripts, with 100 transcripts sequenced for each sample. In control cells, transcripts containing exon 1b were most frequent, with little variability in TSSs for either exon 1a or 1b. (E) Alignment of 5′RACE transcripts from fibroblasts from a C9ORF72 expansion patient (29iC9-ALS). Sequences derived from the wild-type or expansion allele were determined using SNP rs10757668 upstream of the RACE primer in exon 2. Expression of the wild-type allele (blue) was similar to control fibroblasts, whereas the expansion allele (red) showed more frequent usage of exon 1a and more variability in the TSS. (F) Percentage of transcripts containing exon 1a or 1b in C9ORF72 patient fibroblasts (29i and 30i) from the wild-type (A allele, blue) or expansion (G allele, red), showing an increase in the percentage of transcripts containing exon 1a derived from the expansion allele. *P < 0.05, t test, % of transcripts, wild-type versus mutant allele. (G and H) Alignment of 5′RACE from iPSC-derived motor neurons from two different C9ORF72 expansion ALS patients (30iC9-ALS and 29iC9-ALS), showing enhanced expression of the repeat (containing exon 1a), and variability in TSS usage by the mutant allele. (I) Comparison of the number of TSSs observed in fibroblasts from C9ORF72 patients 29i and 30i (right panel) and iPSC-derived motor neurons (left panel). The expansion allele (G, red) showed more TSSs for exon 1a transcripts than did the wild-type allele (A, blue), whereas the number of TSSs for exon 1b was similar between the two alleles. *P < 0.05, t test, no. of TSSs, wild type (A) versus mutant (G).

The GGGGCC expansion in C9ORF72 occurs between the alternatively used exons 1a and 1b (8, 9). Therefore, the repeat is transcribed if exon 1a is used, but is located in the promoter region if exon 1b is used. Because the RNA-seq showed low sampling of exons 1a and 1b and is dependent on existing transcript annotation to determine how the presence of the repeat influences upstream exon use, we performed 5′RACE [rapid amplification of complementary DNA (cDNA) ends] of C9ORF72 transcripts in fibroblasts and iPSC-derived motor neuron cultures. Fibroblasts from a control subject showed transcripts predominantly containing exon 1b, with little variability in transcriptional start sites (TSSs) among exons 1a and 1b (Fig. 2D). Because of the presence of a single-nucleotide polymorphism (SNP) in exon 2 in ~17% of the population (rs10757668) (8), we were able to assign sequences as emanating from either the wild-type or expansion-containing allele in two of the C9-ALS patient fibroblasts (Fig. 2E) and iPSC-derived motor neuron lines (Fig. 2, G and H). The wild-type allele behaved similarly to control subjects, with predominant use of exon 1b. However, the mutant allele showed increased use of exon 1a compared to 1b in C9-ALS patients versus controls (Fig. 2F) and more variability in the location of the TSS (Fig. 2I). Similar findings were present in iPSC-derived motor neurons from C9-ALS patients, with nearly selective use of exon 1a by the mutant allele in some cases (Fig. 2G). Expression of both isoforms was also observed in spinal cords from C9-ALS patients (fig. S6). Together, these data suggest that C9ORF72 expression is not significantly decreased in C9-ALS patient cells, but rather that there is a paradoxical shift toward transcription of the allele with the hexanucleotide repeat, supporting the notion that the C9ORF72 repeat expansion leads to gain of function, rather than loss of function.

Given that the hexanucleotide repeat in C9ORF72 is transcribed, we next performed fluorescence in situ hybridization (FISH) to look for evidence of GGGGCC repeat–containing RNA foci in C9-ALS patient iPSC-derived motor neurons. RNA foci were initially reported in C9-ALS and frontotemporal dementia (FTD) patient tissues (8). Consistent with the observed transcription of the repeat, RNA foci were detected by FISH in ~20% cells in C9-ALS patient motor neuron cultures (Fig. 3A). Cells typically had 1 to 3 foci in the nucleus, but those with >15 foci were not uncommon and occasional cytoplasmic foci were also seen. The fewest RNA foci were observed in line 30i, which harbored only ~70 repeats (fig. S7). Coimmunostaining with FISH revealed that foci were present in neuronal progenitors (nestin+), as well as motor neurons (SMI32+) and astroglial cells in the cultures (GFAP+) (Fig. 3B). RNA foci are directly involved in the pathogenesis of a number of repeat expansion diseases, including myotonic dystrophy type 1 (DM1), where they bind to RNA binding proteins and disrupt their function, leading to changes in gene expression and splicing (28). Therefore, we examined colocalization of RNA foci with a panel of different RNA binding proteins. Confocal imaging revealed that RNA foci frequently colocalized with hnRNPA1 (heterogeneous nuclear ribonucleoprotein A1) and Pur-α (Fig. 3, C and D), but not with hnRNPA3, hnRNPA2/B1, or TDP-43 or FUS (fused in sarcoma) RNA binding proteins, which are mutated in rare cases of familial ALS (Fig. 3, C and D, and fig. S8) (29). These data support the notion that RNA foci contain RNA binding proteins and may share a similar pathogenic mechanism to myotonic dystrophy (30) by disrupting the function of hnRNPA1 and Pur-α. Recently, GGGGCC repeat–associated non-ATG–dependent (RAN) translation products were reported to be present in C9-ALS patient tissues (16, 17). However, we were not able to detect C9-RAN translation products in C9-ALS patient–derived motor neuron cultures (fig. S9) or an increase in p62-positive inclusions, indicating that the presence of GGGGCC repeat–containing RNA foci does not always correlate with the production of insoluble dipeptides by RAN translation.

Fig. 3. iPSC-derived motor neuron cultures from C9-ALS patients develop GGGGCC RNA foci that bind to Pur-α and hnRNPA1.

(A) Representative images of FISH with an antisense probe to the GGGGCC repeat in iPSC-derived motor neuron cultures (lines 83iCTR and 52iC9-ALS). RNA foci were present in cells from all C9-ALS patients, but not in motor neuron cultures from control subjects. RNA foci were predominantly nuclear but occasionally found in the cytoplasm as well. Scale bars, 25 μm. Histogram below shows the number of foci per cell. **P < 0.01, unpaired t test (two-tailed); ***P < 0.0001, Mann-Whitney test, control (all four subjects) versus C9-ALS (all four subjects). (B) Representative images showing costaining of GGGGCC FISH and markers of different cell types in iPSC-derived motor neuron cultures. RNA foci were present in the nuclei of neuronal precursors (nestin-positive; line 29i C9-ALS shown), motor neurons (SMI32-positive; line 28i C9-ALS shown), and astroglial cells (GFAP-positive; line 52i C9-ALS shown). Scale bars, 10 μm. (C and D) Representative images showing costaining of GGGGCC FISH with RNA binding proteins. Colocalization of GGGGCC foci with hnRNPA1 and Pur-α was observed by confocal imaging. White arrows point to foci that stained for both RNA foci and hnRNPA1 or Pur-α in the same focal plane. Adjacent panels show the yz and xz axes confirming colocalization in three dimensions. Scale bars, 10 μm. (C) Line 52iC9-ALS. (D) Line 28iC9-ALS. (E) Heat map showing hierarchical clustering of differentially expressed genes identified by RNA-seq of iPSC-derived motor neuron cultures between four different C9-ALS patients (n = 4; lines 28i, 29i, 30i, and 52i) and four control subjects (n = 4; lines 00i, 03i, 14i, and 83i) with P < 0.05. The arrow indicates motor neuron cultures from the subject with the fewest GGGGCC repeats (~70 in line 30iC9-ALS), which clustered farthest from the three lines with larger repeats (~800). (F) Gene list of the 20 highest up-regulated (blue) and down-regulated (red) genes in C9-ALS patient iPSC-derived motor neuron cultures versus controls. Genes highlighted in yellow include DPP6, implicated in previous ALS GWA studies, and three members of the cerebellin family (CBLN1, CBLN2, and CBLN4). (G) qRT-PCR validation of differentially expressed genes highlighted in (F). All P < 0.05, t test, control (n = 4 subjects) versus C9-ALS (n = 4 subjects). (H) C9-ALS iPSC-derived motor neuron cultures are less excitable (n = 184) than control iPSC-derived motor neuron cultures (n = 137). Recordings were performed on motor neuron cultures that were between days 66 and 79 of differentiation. Representative traces are shown in response to current injections of −10, 0, and 10 pA into motor neurons derived from a control subject (black, iPSC line 83i) or C9-ALS patient (red, iPSC line 28i). Mean number of action potentials elicited as a function of current injection for control (black) and C9-ALS (red) cultured motor neurons. The graph (right) shows the number of spikes fired at different levels of current injection, with reduced numbers of spikes fired in C9-ALS iPSC-derived motor neurons compared to control iPSC-derived motor neurons (iPSC lines 14i and 83i, and C9-ALS iPSC lines 28i and 52i; n = 2 independent experiments). Resting potential and input resistance of the motor neurons are −68.5 mV (with 3.4 gigohms for the control) and −61.5 mV (with 3.2 gigohms for the C9-ALS motor neurons). *P < 0.05; **P < 0.01; ***P < 0.001, C9-ALS versus control, unpaired t test, two-sample, unequal variance.

To examine alterations in gene expression in C9-ALS patient cells, we next analyzed the transcriptome by RNA-seq in C9-ALS iPSC-derived motor neuron cultures versus control iPSC-derived motor neuron cultures (Fig. 3, E and F, and figs. S10 and S11). Hierarchical clustering of differentially expressed genes (P < 0.05) showed that the three C9-ALS lines with ~800 repeats clustered closest to each other, whereas line 30i (~70 repeats) was most distinct within the C9-ALS cluster, suggesting that gene expression alterations correlated with repeat length (Fig. 3E). The list of the differentially expressed genes included DPP6, a gene identified in multiple previous genome-wide association (GWA) studies as being associated with sporadic ALS (3032), the interacting potassium channel KCNQ3, and three members of the cerebellin family of proteins involved in synapse formation (33) (Fig. 3F). Functional pathway analysis of differentially expressed transcripts supported enrichment in genes involved in cell adhesion, synaptic transmission, and neural differentiation (table S2). Validation of a subset of these genes by qRT-PCR confirmed their dysregulation, including DPP6 (Fig. 3G).

Given that expression of several genes involved in regulating membrane excitability (DPP6 and KCNQ3) and synaptic transmission (CBLN1, CBLN2, and CBLN4) was disrupted, we performed detailed electrophysiology on C9-ALS patient–derived motor neurons compared to controls (Fig. 3H and fig. S12). We observed that C9-ALS patient–derived motor neurons showed decreased electrical excitability with the production of fewer spikes upon depolarization, consistent with the expected effect of increased KCNQ3 channel expression (34).

ASOs have been used for gene-specific knockdown in diseases involving RNA or protein gain of function. Recent examples include ASO-mediated ribonuclease H–dependent degradation of CTG repeat–containing “toxic” RNA transcripts in DM1 (35) and CAG repeat–containing transcripts in Huntington’s disease (36). Given that we observed both transcription of the hexanucleotide repeat and formation of RNA foci with concomitant changes in gene expression in C9-ALS patient cells, we investigated whether ASOs targeting C9ORF72 could alter these disease-specific cellular phenotypes. We used two ASOs: one targeting exon 2, which is common to all transcripts (ASO816), and a second targeting the region in intron 1 adjacent to the repeat (ASO061) (Fig. 4A). Treatment of iPSC-derived motor neuron cultures with ASO816 led to knockdown of total C9ORF72 transcript levels by ~90% (Fig. 4B), with no observed toxicity to cultured motor neurons (fig. S13). ASO061, which targets the first intron, led to a small decrease in C9ORF72 transcript levels (Fig. 4B) but altered upstream exon use, leading to more exon 1b than exon 1a (repeat-containing) transcripts, as determined by RACE analysis (Fig. 4C and fig. S13). We next examined the effect of ASOs targeting C9ORF72 on the formation of GGGGCC repeat–containing RNA foci. Both ASO816 (which knocks down overall C9ORF72 levels) and ASO061 (which specifically targets repeat-containing transcripts) led to suppression of RNA foci formation in C9-ALS patient iPSC-derived motor neurons (Fig. 4D). To determine whether knockdown of C9ORF72 expression and RNA foci could reverse disease-specific transcriptional changes, we performed qRT-PCR of DPP6, CBLN1, CBLN2, CBLN4, and SLITRK2 in iPSC-derived motor neurons from ALS patients and controls. Remarkably, motor neurons treated with ASO816 showed partial but significant correction (P < 0.01) of the overexpression of these five genes observed in patient cells (Fig. 4E), with similar results obtained for ASO061 (fig. S13). To more broadly assess reversal of transcriptional changes across all of the differentially expressed genes in C9-ALS patient iPSC-derived motor neuron cultures (Fig. 3F), we performed RNA-seq analysis of control and C9-ALS motor neurons, treated with either scrambled ASO or ASO816 (fig. S13B). We observed concordance with the original RNA-seq analysis, with 93% of genes showing dysregulation in C9-ALS patient iPSC-derived motor neuron cultures compared to controls in both experiments. Furthermore, 50% of the up-regulated genes and 18% of the down-regulated genes showed significant reversal toward a control cell phenotype after treatment with ASO816 (P < 0.05) (fig. S13B). These data provide further evidence that the hexanucleotide expansion causes gain-of-function toxicity because C9ORF72 knockdown corrected the transcriptional profile, rather than exaggerating altered gene expression.

Fig. 4. Knockdown of C9ORF72 with ASOs suppresses RNA foci in ALS motor neurons.

(A) Schematic diagram of C9ORF72 gene structure, showing the location of ASOs 816 and 061, and primers for assaying C9ORF72 expression in exon 2. (B) qRT-PCR for total C9ORF72 in iPSC-derived motor neurons (C9-ALS lines 28iC9-ALS and 52iC9-ALS) treated with ASOs 816 and 061. ASO816, which targets the first coding exon common to all C9ORF72 isoforms, knocked down overall C9ORF72 levels by ~90%. ASO061 had a partial effect on total transcript levels. {one-way ANOVA Tukey’s multiple comparison test; 95% CI of difference, −0.1713 to 0.4167 [untreated versus scrambled (n.s., not significant)], −0.006394 to 0.5816 [scrambled versus ASO061 (not significant)], −0.5671 to 1.155 [scrambled versus ASO816 (***)], and −0.8675 to −0.2796 [ASO816 versus ASO061 (**)]}. Data are represented as means ± SEM from n = 3 independent experiments. (C) 5′RACE analysis (line 52iC9-ALS shown) to analyze 5′ exon use after treatment with either scrambled ASO (left) or ASO061 (right). Although ASO061 did not alter total C9ORF72 transcript levels, it suppressed exon 1a–containing transcripts, with a relative increase in exon 1b–containing transcripts. (D) Representative images of RNA FISH on C9-ALS patient motor neuron cultures (lines 29i C9-ALS and 52i C9-ALS) treated with different ASOs [scrambled (Scr.), 816, and 061], showing a marked suppression of RNA foci in ASO-treated cells. Scale bars, 10 μm. Graphs below show quantitation of the percentage of cells with foci (left) and a histogram showing the breakdown by foci per cell (right). **P < 0.01; *P < 0.05, unpaired t test (two-tailed). (E) qRT-PCR for genes that showed aberrant up-regulation in C9-ALS iPSC-derived motor neuron cultures (DPP6, CBLN1, CBLN2, CBLN4, and SLITRK2) after treatment with scrambled ASO or ASO816 (lines 14iCTR and 52iC9-ALS shown). Error bars are means ± SEM. ***P < 0.001; **P < 0.01, unpaired t test (two-tailed), scrambled versus ASO816.

DISCUSSION

Repeat expansions produce human disease through a variety of mechanisms. In fragile X syndrome and Friedreich’s ataxia, large repeats in noncoding regions lead to gene silencing and loss of function (37, 38), whereas in many spinocerebellar ataxias (SCA) and Huntington’s disease, expansions in gene-coding regions predominantly lead to protein toxicity (39, 40). In repeat diseases including myotonic dystrophy, expansions in noncoding transcribed regions can produce toxic RNA species, which sequester RNA binding proteins and disrupt gene splicing and transcription to mediate disease (41, 42). Some noncoding repeats including those in DM1 and SCA8 were shown to produce non-ATG–initiated peptides, which could also play a role in disease pathogenesis (43); similarly generated peptides were recently demonstrated in C9-ALS patient tissue (16, 17). Our data support gain of function as the mechanism of C9ORF72 repeat toxicity because the mutant allele was preferentially transcribed rather than suppressed in ALS patient iPSC-derived motor neurons. Furthermore, knockdown of C9ORF72 to low levels (10% residual) in iPSC-derived motor neurons from control individuals was not toxic. The fact that RNA foci were present and colocalized with hnRNPA1 and Pur-α supports the notion that RNA toxicity contributes to C9ORF72 repeat expansion diseases. The GGGGCC repeat did not directly bind to TDP-43, but hnRNPA1 is a well-characterized binding partner for TDP-43 (44). Therefore, sequestration of this protein by RNA foci could alter the effect of TDP-43 on its target RNAs, thus providing a potential connection between TDP-43– and C9ORF72-related ALS. Notably, mutations in both hnRNPA1 and hnRNPA2/B1 were recently reported to cause motor neuron disease in humans (45), further supporting the notion that altered hnRNPA1 function can promote motor neuron degeneration. Additionally, Pur-α was recently shown to interact with GGGGCC repeat–containing RNA foci and to modulate the toxicity of these foci in a fly model (46). Given that multiple RNA binding proteins colocalize with the RNA foci, it remains to be determined whether the toxicity to motor neurons is primarily due to altered levels of individual proteins, or a combination of them. Although it will take further work to determine whether the transcriptional alterations observed in C9-ALS patient iPSC-derived motor neurons are a direct or indirect consequence of altered RNA binding protein function, the fact that DPP6, a gene implicated in sporadic ALS in multiple independent GWA studies (3032), was dysregulated suggests that these alterations reflect pathways directly relevant to ALS pathogenesis.

Several papers reported a decrease in the expression of C9ORF72 in patient tissue (8, 10, 14, 19) using qRT-PCR. Although we observed a trend toward lower overall C9ORF72 mRNA levels via RNA-seq and qRT-PCR, it was not statistically significant. One reason for the discrepancy is likely to be that qRT-PCR cannot accurately sample all versions of exons 1a and 1b, which we observed were different and varied in location compared to the annotation databases used to make primer sets for qRT-PCR. Another reason is that some studies investigated autopsy material, which could show a decrease in C9ORF72 levels because of neuronal cell loss; additionally, cell lines derived from blood cells may not reflect expression levels in human motor neurons. Furthermore, we found that knockdown of C9ORF72 to very low levels had no impact on motor neuron survival. Finally, the altered gene expression profiles observed in C9-ALS patient cells was improved rather than worsened by C9ORF72 knockdown with ASOs, supporting the notion that these changes are due to gain of function of the C9ORF72 repeat, rather than loss of function. Therefore, although it remains possible that the expansion leads to a small decrease in overall C9ORF72 expression, this does not appear to result in a functional deficit.

Although we did find evidence for toxic RNA foci in C9-ALS patient iPSC-derived motor neurons, we did not observe repeat-associated non-ATG–dependent (C9-RAN) protein products in these cells. This is in contrast to another study (47), which observed C9-RAN–positive material in neurons generated from patient iPSCs. One reason for the difference may be that this study generated generic neurons, rather than the motor neurons characterized here, and the production of RAN products may be neuronal cell type–dependent. Regardless of whether C9-RAN products or toxic RNA granules (or both) are key to the pathogenesis of C9ORF72 repeat expansion diseases, our data support the possibility that knockdown of C9ORF72 by ASOs could reverse gain-of-function toxicity.

There are currently no effective treatments for ALS or FTD, and debate continues as to which model systems will most accurately predict success in subsequent clinical trials. Here, we have used iPSC technology to demonstrate robust patient-specific phenotypes in the disease-relevant cell type. Given that the ASOs targeting the region adjacent to the C9ORF72 repeat were able to alter upstream exon use to block transcription of repeat-containing RNA, it may be possible to suppress the toxic effects of C9ORF72 repeat transcription (whether RNA- or protein-mediated) while avoiding potential unforeseen consequences of knocking down overall C9ORF72 levels. Given the urgent need for effective drug development for ALS and FTD patients and the relatively high frequency of C9ORF72 repeat expansions with an estimated 90,000 carriers in the UK (24), these data provide a basis for moving toward attempting antisense strategies to treat C9ORF72 repeat expansion diseases.

MATERIALS AND METHODS

Study design

Here, we used iPSC and ASO technologies (i) to determine whether expansions of a hexanucleotide repeat (GGGGCC) in the noncoding region of the C9ORF72 gene of ALS patient motor neurons caused disease through gain- or loss-of-function mechanisms, and (ii) to discover potential therapeutics by targeting those disease mechanisms. We included four healthy control individuals and four C9ORF72 repeat expansion–associated ALS (C9-ALS) patients, generated nonintegrating iPSC lines using an episomal plasmid–based approach, and differentiated them into neural cultures containing motor neurons. We then determined in iPSC-derived motor neuron cultures from all eight individuals (four control and four C9-ALS) the following: (i) C9ORF72 repeat stability by Southern blot analysis, (ii) motor neuron cell death vulnerability in C9-ALS cultures over time by performing cell counts, (iii) C9ORF72 expression and C9-ALS disease–specific transcriptome profiles using RNA-seq and qRT-PCR, (iv) expression and localization of C9ORF72 protein by subcellular fractionation and Western blot analysis, (v) use of upstream C9ORF72 exons and transcription start sites by 5′RACE PCR, (vi) formation and quantification of RNA foci structures and colocalization with RNA binding proteins by RNA FISH/immunocytochemical staining and confocal microscopy, (vii) electrical excitability patterns of motor neurons upon depolarization by performing patch-clamp electrophysiology, and (viii) rescue of the observed C9-ALS disease–specific cellular phenotypes by treating motor neuron cultures with ASOs targeting different regions of C9ORF72. Excluding electrophysiological assessments, all experiments described here were assessed in four control and four C9-ALS patient–derived motor neuron cultures in three or more independent experimental replicates in a blinded fashion. Electrophysiology recording experiments were performed twice independently in a blinded method in motor neuron cultures from two control individuals and two C9-ALS patients.

Ethics statement

Human control fibroblast cell lines were obtained from the Coriell Institute for Medical Research. The Coriell Cell Repository maintains the consent and privacy of the donor of fibroblast samples. All the cell lines and protocols in the present study were carried out in accordance with the guidelines approved by institutional review boards at the Cedars-Sinai Medical Center and Washington University at St. Louis.

Generation of C9ORF72 ALS and healthy control iPSCs using episomal plasmids

Fibroblasts from C9ORF72 ALS patients (28iALS-n2, 29iALS-n1, 30-iALS-n1, and 52iALS-n6) were derived at Washington University of St. Louis. Healthy control fibroblasts (00iCTR-n2: GM05400; 14iCTR-n6: GM03814; 83iCTR-n13: GM02183) were obtained from the Coriell Institute for Medical Research or derived from healthy donors at Cedars-Sinai (03iCTR-n1). Reprogramming of the lines was performed with pCXLE-hUL, pCXLE-hSK, and pCXLE-hOCT3/4-shp53-F vectors [Addgene, adapted from previously published protocols (20)]. Amaxa Human Dermal Fibroblast Nucleofector Kit was used to make the virus-free iPSC ALS lines. Briefly, fibroblasts (0.8 × 106 cells per nucleofection) were harvested and centrifuged at 200g for 5 min. The cell pellet was resuspended carefully in Nucleofector Solution (VPD-1001, Lonza) and combined with episomal plasmid expression of six factors: OCT4, SOX2, KLF4, L-MYC, LIN28, and p53 shRNA, achieved by plasmid nucleofection (20). This method has a significant advantage over viral transduction because genes do not integrate and are instead expressed episomally in a transient fashion. The cell/DNA suspension was transferred into the Nucleofector, and the U-023 program was applied. All cultures were maintained under normal oxygen conditions (5% O2) during reprogramming, which further enhances the efficiency of iPSC generation. The medium was kept for 48 hours and gradually changed to hiPSC medium containing small molecules to enhance reprogramming efficiency. The small molecules used were (i) sodium butyrate (0.5 mM), (ii) glycogen synthase kinase 3β inhibitor of the Wnt/β-catenin signaling pathway (CHIR99021, 3 μM), (iii) mitogen-activated protein kinase kinase pathway inhibitor (PD 0325901, 0.5 μM), (iv) selective inhibitor of transforming growth factor–β type I receptor ALK5 kinase, type I activin/nodal receptor ALK4, and type I nodal receptor ALK7 (A 83-01, 0.5 μM). Colonies with embryonic stem/iPSC–like morphology appeared 25 to 31 days later. Subsequently, colonies with the best morphology were picked and transferred to layers with standard hiPSC medium and BD Matrigel Matrix for feeder-independent maintenance of hiPSCs in chemically defined mTeSR1 medium. Three independent iPSC clones will be picked from each reprogrammed fibroblast sample, further expanded, and cryopreserved according to previously published protocols (48).

iPSC characterization

Rigorous characterization of iPSC cells was performed at the Cedars-Sinai iPSC core using standard battery of pluripotency assays, including pluripotency surface and nuclear marker immunostaining and quantification by flow cytometry (>80% SSEA4 and OCT3/4 double positivity), G-band karyotyping to ensure normal karyotypes, spontaneous embryoid body differentiation to judge germ layer formation capacity, gene-chip and bioinformatics-based PluriTest assay, qRT-PCR for expression of endogenous pluripotency genes, and confirmation of absence of episomal plasmid genes by genomic DNA PCR, as previously described (20, 21, 23).

Motor neuron differentiation

The iPSCs were grown to near confluence under normal maintenance conditions before the start of the differentiation. Briefly, neural differentiation of iPSC colonies was induced by removal of mTeSR1 medium and addition of defined neural differentiation medium (SaND) composed of Iscove’s modified Dulbecco’s medium supplemented with B27–vitamin A (2%) and N2 (1%).The cells were treated with this medium for 6 days. The culture medium was replenished every 2 to 3 days. On day 6, the cultures were gently lifted from Matrigel by Accutase treatment for 5 min at 37°C. Single-cell suspension at a density of 10,000 cells per well was centrifuged in the presence of Matrigel and SaND medium supplemented with the caudalizing factor all-trans retinoic acid (ATRA; 0.1 μM) in sterilized 384-well PCR plates for formation of uniform-sized neural aggregates. After 2 days (day 8), neural aggregates were cultured in suspension low-attachment flasks grown for a further 9 days. To induce motor neuron differentiation, at day 17 post-iPSC stage, we placed caudalized neural aggregates in stage 1 motor neuron induction medium (Neurobasal, 2% B27 and 1% N2) in the presence of ATRA (0.1 μM) and the ventralizing factor purmorphamine (PMN; 1 μM) for a further 8 days. Partially or fully dissociated caudo-ventralized neural aggregate spheres were then plated on poly-ornithine/laminin–coated coverslips in motor neuron maturation medium consisting of Dulbecco’s modified Eagle’s medium (DMEM)/F12, supplemented with 2% B27, ATRA (0.1 μM), PMN (1 μM), dibutyryl cyclic adenosine monophosphate (1 μM), ascorbic acid (200 ng/ml), brain-derived neurotrophic factor (10 ng/ml), and glial cell line–derived neurotrophic factor (10 ng/ml) for a further 2 to 7 weeks. These conditions allowed for motor neuron differentiation under serum-free conditions. All differentiating cultures were maintained in humidified incubators at 37°C (5% CO2 in air).

Electrophysiology

Induced pluripotent human motor neurons derived from fibroblasts of healthy or diseased patients were studied with a blinded experimental design at 9 to 10 weeks after differentiation. Cells were cultured on laminin-coated coverslips and placed in extracellular solution [119 mM NaCl, 26 mM NaHCO3, 11 mM glucose, 2.5 mM KCl, 2.5 mM CaCl2, 1.3 mM MgCl2, and 1 mM NaH2PO4 (pH 7.4), when gassed with 5% CO2 and 95% O2]. Motor neurons were identified on the basis of their characteristic trapezoidal shape, with more than two dendritic processes visualized with an upright microscope (Leica) with a ×40 water immersion objective and constantly perfused with carbogen-bubbled extracellular solution at a rate of 2.8 to 3 ml/min. Most of the cells (43 of 60) elicited action potentials upon current injection, which were blocked by tetrodotoxin. Recordings were made with borosilicate glass pipettes with resistances between 4 and 5 megohms when filled with internal pipette solution [135 mM KMSO4, 10 mM NaCl, 10 mM Hepes, 3 mM MgATP, 0.3 mM Na2GTP, 0.1 mM EGTA, and 100 μM Alexa Fluor 594 hydrazide (Molecular Probes), adjusted to pH 7.4]. Whole-cell recordings were made with a MultiClamp 700B amplifier (Molecular Devices) in current-clamp mode. Each cell was subjected to a series of increasing current injections from –10 to 70 pA in steps of 5 or 10 pA. Currents were filtered at 4 kHz and sampled at 20 kHz with Digidata 1440 (Axon Instruments). Spike detection and analysis was performed with pClamp 10, and further analysis was carried out in Excel or Igor software. Figures were made in Igor. The results are reported as means ± SEM.

Immunocytochemistry

At the appropriate time point of differentiation in culture, plated cells were fixed in paraformaldehyde (PFA) [4% (v/v)] or chilled acetone/methanol (1:1) and rinsed in phosphate-buffered saline (PBS). Fixed cultures were blocked in 5 to 10% (v/v) goat or donkey serum with 0.2% (v/v) Triton X-100 and incubated with primary antibodies (table S2). After incubation with the primary antibodies, cultures were rinsed in PBS and incubated in species-specific Alexa Fluor 488– or Alexa Fluor 594–conjugated secondary antibodies. Nuclei were counterstained with Hoechst 33258 (0.5 μg/ml; Sigma) and mounted on glass slides with GelTol Aqueous Mounting Medium (Immunotech). Visualization was performed at ×10, ×20, and ×63 magnifications (Nikon/Leica), and quantification of positive cells was completed with MetaMorph Offline software (Molecular Devices).

Plasmids

C9ORF72 cDNA transcript variant 1 (NM_145005.5) and transcript variant 2 (NM_018325.1) were purchased from Origene [pCMV6-C9ORF72-TV1-myc-DDK (catalog no. RC222418) and pCMV6-C9ORF72-TV2-myc-DDK (catalog no. RC209700)].

Antisense oligonucleotides

The ASOs were added at a concentration of 3 μM to the motor neuron maturation medium only on the designated first day of treatment. Only a single treatment was performed. Knockdown was observed after 7 days, and this knockdown persisted through at least 14 days without additional treatment. The time point for assessment of mRNA knockdown, protein knockdown, foci reduction, and ASO reversal was all performed at 14 days after ASO treatment. The medium was changed normally for the duration of treatment until the cells were fixed. Target sequences were as follows: control ASO-141923, CCTTCCCTGAAGGTTCCTCC; exon 2 ASO-576816, GCCTTACTCTAGGACCAAGA; isoform-specific ASO-577061, TACAGGCTGCGGTTGTTTCC.

Primary antibodies

The following antibodies were used for Western blot analysis: anti-TARDBP (Proteintech Group, 10782-2-AP), anti-C9ORF72 (GeneTex, GTX119776), anti–glyceraldehyde-3-phosphate dehydrogenase (Sigma-Aldrich, G8795), anti–epidermal growth factor receptor (Thermo Scientific, PA1-1110), and anti-SP1 (Millipore, 07-645). The anti-C9RANT antibody was previously described (16).

RNA isolation and real-time qRT-PCR

RNA was collected from motor neuron cultures with PureLink RNA Mini Kit (Ambion). RNA (1 μg) was first deoxyribonuclease-treated and then reverse-transcribed to cDNA with oligo(dT) with the Promega Reverse Transcriptase System. qPCRs were performed in triplicate with SYBR Green Master Mix (Applied Biosystems). Genes of interest were normalized to RPL13 ribosomal protein L13A and calculated by the 2−ΔΔCT method (49). PCR products were amplified with the following primers: C9ORF72, 5′-TGTGACAGTTGGAATGCAGTGA-3′ (forward) and 5′-GCCACTTAAAGCAATCTCTGTCTTG-3′ (reverse); RPL13 ribosomal protein L13A, 5′-CCTGGAGGAGAAGAGGAAAGAGA-3′ (forward) and 5′-TGAGGACCTCTGTGTATTTGTCAA-3′ (reverse); CBLN1, 5′-TCAGAACGCAGCACTTTCATC-3′ (forward) and 5′-TTTAGCATGAGGCTCACCTGT-3′ (reverse); CBLN2, 5′-CGACCGGTGCTTTTAAGGGT-3′ (forward) and 5′-CGAAGTTGCTCCAAACGCC-3′ (reverse); CBLN4, 5′-CAGATCCTGGTGAATGTGGGT-3′ (forward) and 5′-AGTTAACCTGGATAGTTTGGCTCT-3′ (reverse); and SLITRK2, 5′-CCAAGTCTCCTGTGCCTCTC-3′ (forward) and 5′-CAGGTCAGAGATATTAGTGA-3′ (reverse). Each PCR cycle consisted of 95°C for 10 min, 95°C for 30 s→58°C for 60 s, for 50 cycles, and 72°C for 5 min. The melting curve was measured and recorded from 65° to 95°C in increments of 0.05° to 0.5°C.

Western and dot blot analysis

293T cells were maintained in DMEM plus 10% fetal bovine serum, 1% Glutamax, and 1% nonessential amino acids. Transient transfection was performed in a six-well plate with 1 μg of DNA and 3 μl of Mirus transfection reagent. 293 T cells were transfected with C9ORF72 transcript variants 1 and 2 as positive controls for the identification of endogenous C9ORF72 in the motor neuron cultures. Whole-cell lysates from 293T cells were washed twice with 1× PBS and lysed in buffer containing 50 mM tris-HCl (pH 8.5), 100 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 0.5% NP-40, 1 mM phenylmethylsulfonyl fluoride (PMSF), and a complete protease inhibitor pellet (Roche). For subcellular protein fractionation, motor neuron cultures were washed twice with ice-cold 1× PBS and collected by centrifugation at 3000 rpm for 5 min. About 20 μl of cells from three control and three ALS motor neuron cultures was fractionated in triplicate following the protocol in the Subcellular Protein Fractionation Kit for Cultured Cells from Thermo Scientific.

For soluble/insoluble fractionation, motor neuron cultures were washed twice with ice-cold 1× PBS and collected in lysis buffer [10 mM tris (pH 7.4), 1% Triton X-100, 150 mM NaCl, 10% glycerol, 0.2 mM PMSF, and Roche complete protease mini and phosphoSTOP pellets]. Cells collected were first sheared in a glass Dounce homogenizer and then lysed on ice for 60 min before centrifugation at 15,000g for 20 min at 4°C. Supernatant was collected as the detergent-soluble fraction. The pellet was washed three times with lysis buffer and centrifuged at 15,000g for 5 min each at 4°C. The pellet was resuspended in lysis buffer supplemented with 4% SDS, sonicated three times, boiled for 30 min, and collected as the detergent-insoluble fraction. Soluble/insoluble fractionation protocol was previously described (50) with minor changes in protease/phosphatase inhibitors and the addition of sonication to resuspend the detergent-insoluble pellets. For dot blot analysis for C9RANT products from human brain, tissue was processed as previously reported (16).

All protein concentrations were determined with the BCA protein assay kit (Thermo Scientific), separated with SDS–polyacrylamide gel electrophoresis, and transferred onto polyvinylidene difluoride (PVDF) membrane, and Western blot analysis was performed following standard protocols (Bio-Rad). Protein extracts (10 to 30 μg) were denatured in Laemmli sample buffer, boiled for 5 min and then resolved on either a 10% or Any kD gel (Bio-Rad). After electrophoresis (150 V for 1.5 hours), the proteins were transferred with Bio-Rad’s Trans-Blot Turbo Transfer System and Transfer Pack to a 0.2-μm PVDF membrane, with a constant current of 2.5 A up to 25 V for 5 or 7 min. The membranes were then blocked in 5% nonfat dry milk/tris-buffered saline (TBS)–Tween 20 (TBST) solution for 1 hour at room temperature and incubated overnight at 4°C with the primary antibodies. The membranes were washed three times with TBST, incubated with horseradish peroxidase–linked goat anti-mouse or anti-rabbit antibodies (Jackson ImmunoResearch) for 1 hour at room temperature, and then washed three times in TBST. Detection of the immunoreactive bands was performed with the SuperSignal West Dura Extended Duration Substrate (Thermo Scientific), and chemiluminescence was detected with the Bio-Rad imaging system. PVDF membranes were stripped with One Minute Plus Western Stripping Buffer (GM Biosciences) and reprobed with the appropriate subcellular antibody markers.

Quantitation and statistical analysis

Western blot quantitation was performed with ImageJ 1.46r software (National Institutes of Health). Experiments were performed in triplicate, and values are presented as means ± SEM. All statistical evaluations were performed with GraphPad Prism software using unpaired t test to compare the two groups. The Prism software (GraphPad Software) was used for all statistical analyses. All counting data from immunocytochemical/histochemical analyses and cell survival were expressed as mean values ± SEM and analyzed by two-tailed t test or two-way ANOVA with Bonferroni post hoc test. Differences were considered significant when P < 0.05

Southern blot quantification of C9ORF72 expansion size

Genomic DNA (10 μg) was isolated from either patient-derived cell lines (fibroblasts, iPSCs, or motor neuron cultures). Fragment electrophoresis at 20 V for 24 hours was performed on a 0.8% SeaKem GTG agarose gel (Takara) with 1× tris-borate EDTA, with subsequent transfer to GeneScreen Plus nylon membranes (PerkinElmer). A 590–base pair (bp) probe containing the smaller published probe gave improved sensitivity and was generated by PCR with the following primers: forward, 5′-AAATTGCGATGACTTTGCAGGGGACCGTGG; reverse, 5′-GCTCTCACAGTACTCGCTGAGGGTGAACAA. After gel purification, the probe was labeled with [32P]deoxycytidine triphosphate (PerkinElmer) using the Random Primed DNA labeling kit (Roche) and purified using Ambion NucAway spin columns (Life Technologies). Hybridization was carried out overnight at 68°C in PerfectHyb Plus buffer (Sigma) containing salmon sperm DNA (100 μg/ml) (Life Technologies/Invitrogen). Filters were washed twice for 5 min at room temperature with 2× SSC + 0.1% SDS and twice for 20 min at 68°C with 0.2× SSC + 0.1% SDS. BioMax MS film (Kodak) was exposed with an intensifying screen at −80°C for 5 days.

5′RACE analysis

Total RNA was isolated from fibroblasts and precursor motor neuron cultures with the PureLink RNA Mini Kit as per the manufacturer’s protocol (Ambion BY Life Technologies, catalog no. 12183018A). 5′RACE was performed with the GeneRacer kit (Invitrogen, catalog no. L1502-02) according to the manufacturer’s instructions modified as follows: 2 μg of total RNA was used for each sample. RNA was treated with calf intestinal phosphatase to remove the 5′ phosphates from any truncated mRNA. Dephosphorylated RNA was treated with tobacco acid pyrophosphates to remove the 5′ cap from full-length mRNA, leaving a 5′ phosphate. The GeneRacer RNA oligomer was then ligated to the 5′ end of the mRNA using T4 RNA ligase. First-stand cDNA was synthesized with SuperScript III reverse transcriptase using random hexamer primers. From this reaction, 1 μg of cDNA was used to amplify the 5′ ends for sequencing with Platinum Taq DNA Polymerase High Fidelity (Invitrogen, catalog no. 12532-016), the GeneRacer 5′ primer (5′-CGACTGGAGCACGAGGACACTGA-3′), and a C9ORF72 gene–specific primer (5′-AACTGGAATGGGGATCGCAGCACAT-3′) with cycling parameters as described in the GeneRacer kit manual: 1 cycle of 94°C for 2 min; 35 cycles of 94°C for 24 s, 55°C for 30 s, and 72°C for 1 min; then 1 cycle of 72°C for 2 min; and finally 4°C for holding. The unused primers and nucleotides were removed using two different techniques for the fibroblasts and precursor motor neurons.

The fibroblast primary PCR products were treated with EXOSAP-IT (Affymetrix, catalog no. 78200). One microliter of the EXOSAP-IT fibroblast amplification products was diluted in 10 μl of water and electrophoretically separated in a 2% agarose gel incorporated with ethidium bromide, and three band products (469, 474, and 574 bp) were visualized by ultraviolet light transillumination. Once confirmed, the secondary PCR was performed with GoTaq (Promega, catalog no. PRM8297), internal primers (GeneRacer, 5′-GGACACTGACATGGACTGAAGGAGTA-3′; C9ORF72 gene–specific, 5′-GTGATGTCGACTCTTTGCCCACCGC-3′), and 1 μg of the primary PCR. The secondary PCR cycling parameter for fibroblasts is as indicated: 1 cycle of 94°C for 2 min; 15 cycles of 94°C for 24 s, 55°C for 30 s, and 72°C for 1 min; then 1 cycle of 72°C for 2 min.

More extensive methods were taken when purifying the precursor motor neurons. It was indicative that ExoSAP-IT was unable to remove the excess primers and nucleotides by the multiple bands that were present on the 3% agarose gel after being solely treated with EXOSAP-IT. The primary PCR products were gel-purified before proceeding with the nested PCR. Fifteen microliters of the primary PCR product was run on a 1.5% gel, and bands located between 400 and 600 bp were removed. One microliter of the 12-μl elution was used as a template in the nested PCR. In addition, a hot start touchdown PCR method was used to minimize mispriming and extension, increase specificity, and reduce background amplification on the secondary PCR of the motor neurons. The secondary PCR cycling parameter for precursor motor neurons was modified as follows: 1 cycle of 94°C for 2 min; 5 cycles of 94°C for 20 s and 72°C for 1 min, 94°C for 30 s, and 70°C for 1 min; 6 cycles of 94°C for 30 s, 68°C for 30 s, decreasing by 2°C every 30 s and 68°C for 30 s; 14 cycles of 94°C for 30 s, 65°C for 30 s, and 68°C for 30 s; then 1 cycle of 68°C for 10 min; and finally 4°C for holding.

Fifteen micrograms of the secondary PCR products, overall, was run on a 1.5% agarose gel, and bands located between 150 and 300 bp (163, 168, and 268 bp) were collected and eluted in 12 μl of water. One microliter of the gel-purified secondary PCR product was cloned with pCR4-TOPO vector (Life Technologies, catalog no. K4575-01) and transformed in TOP 10 cells grown overnight on kanamycin agar plates. Colonies were handpicked and sent to GeneWiz sequencing for analysis.

Cell counting

Several pictures were taken in a nonbiased fashion of each of the slides. Total cell count was obtained by Hoechst staining using the MetaMorph nuclei counting program. The other marker cell counts were done by the investigators. Methods for counting were standardized.

RNA-seq and microarray analysis

For RNA-seq analysis, iPSC cultures were differentiated to motor neurons as above and harvested with an Ambion extraction kit. mRNA was isolated, and library preparation and sequencing were performed on the Illumina Hi-Seq platform for 100-bp paired-end reads. The resultant reads were aligned to the hg19 build of the human genome with BOWTIE and imported to Partek software for gene annotation and differential expression analysis.

FISH and FISH/immunocytochemical staining

The cells were grown on a four-well chamber slide (Lab-Tek II chamber slide system, catalog no. 154917, Thermo Fisher Scientific) and fixed with 4% PFA (catalog no. 15714, Electron Microscopy Sciences) in PBS. The cells were then permeabilized with diethyl pyrocarbonate (DEPC)–PBS/0.2% Triton X-100 (Fisher Scientific, catalog no. BP151) and washed with DEPC-PBS. Hybridization buffer (400 μl) consisting of 50% formamide (IBI Scientific, catalog no. IB72020), DEPC–2× SSC [300 mM sodium chloride, 30 mM sodium citrate (pH 7.0)], 10% (w/v) dextran sulfate (Sigma-Aldrich, catalog no. D8960), and DEPC–50 mM sodium phosphate (pH 7.0) was added to each slide. The probe sequence was LNA oligonucleotide #500150 (/5TYE563/CCCCGGCCCCGGCCCC; Exiqon Inc.). Glass coverslip was applied, and slides were placed in a slide holder (microscope slide folder, Thermo Fisher Scientific Inc., catalog no. 22-244-026) and prehybridized for 30 min at 66°C. The hybridization buffer was then allowed to drain off, and 400 μl of 40 nM probe mix in hybridization buffer was added to each of the slides. The coverslip was reapplied, and hybridization was performed for 3 hours at 66°C in the dark. The samples were then rinsed once in DEPC–2× SSC/0.1% Tween 20 (Fisher Scientific, catalog no. BP337) at room temperature and in DEPC–0.1× SSC three times at 65°C. Finally, incubation with DAPI (1 μg/μl) (Molecular Probes Inc., catalog no. D21490) was performed, and the slides were mounted with ProLong Gold antifade reagent (Molecular Probes Inc., catalog no. P36931). The processed slides were stored overnight at 4°C in the dark before performing microscopic analysis. To investigate the cell types harboring RNA foci, we added a modified immunofluorescence protocol to the hybridized specimens. RNA FISH was done as mentioned above up to the steps of posthybridization DEPC–0.1× SSC washes. The slides were blocked for 15 min with 10% horse serum in TBS/0.5% Triton X-100 and then incubated overnight at 4°C in a humid chamber with one of the following antibodies: anti-nestin (rabbit polyclonal, 1:1000 dilution, EMD Millipore, catalog no. AB5922), anti–neurofilament H nonphosphorylated (SMI32; mouse monoclonal, 1:1000, Covance, catalog no. SMI-32R), anti-GFAP (rabbit polyclonal, 1:1000, Dako, catalog no. Z0334), anti–N-terminal TARDP (rabbit polyclonal, 1:1000, Proteintech Group, catalog no. 10782-2-AP), anti-hnRNPA1 (mouse monoclonal, 1:1000, GeneTex, catalog no. GTX25832), or anti-FUS (rabbit polyclonal, 1:100, MBL International Co., catalog no. JM-3771-100). Alexa Fluor 488–conjugated secondary antibodies [goat anti-rabbit immunoglobulin G (IgG), catalog no. A11034, or goat anti-mouse IgG, catalog no. A11029, Molecular Probes Inc.] were used at 1:1000 dilution for 30 min at room temperature. Incubation with DAPI was done as described above, and the slides were mounted with ProLong Gold antifade reagent. The processed slides were stored overnight at 4°C in the dark before performing microscopic analysis.

SUPPLEMENTARY MATERIALS

www.sciencetranslationalmedicine.org/cgi/content/full/5/208/208ra149/DC1

Fig. S1. Characterization of C9ORF72 patient and control iPSCs.

Fig. S2. Confirmation of the absence of exogenous pluripotency genes in C9ORF72 patient iPSCs and generation of motor neuron precursors.

Fig. S3. Generation of control subject motor neuron cultures from iPSCs.

Fig. S4. RNA-seq analysis of SNP rs1075766 for identification of wild-type and expansion alleles, and differential C9ORF72 transcript analysis from Ref-seq and Ensembl annotations.

Fig. S5. C9ORF72 protein and antibody characterization.

Fig. S6. 5′RACE and qRT-PCR analysis of C9ORF72 in human ALS patient spinal cords.

Fig. S7. RNA foci quantitation in iPSC-derived motor neuron cultures from individual patients.

Fig. S8. Characterization of binding of GGGGCC RNA foci to known hnRNPs and ALS-related factors in C9-ALS motor neuron cultures by confocal imaging.

Fig. S9. C9RANT and p62 inclusions were not observed in C9-ALS motor neuron cultures.

Fig. S10. Summary of RNA-seq analysis in iPSC-derived motor neurons from C9-ALS patients versus controls.

Fig. S11. Hierarchical clustering analysis of RNA-seq data in iPSC-derived motor neurons from C9-ALS patients versus controls.

Fig. S12. Electrophysiological properties of control and C9-ALS patient–derived motor neurons separated by individual subject.

Fig. S13. Absence of any ASO toxicity in motor neuron cultures and reversal of transcription profiles by RNA-seq in iPSC-derived motor neurons.

Table S1. Clinical information on subjects with C9ORF72 hexanucleotide expansions and controls used for iPSC lines in this study.

Table S2. Functional pathway analysis of differentially expressed genes in iPSC-derived motor neuron cultures from C9-ALS patients versus controls.

REFERENCES AND NOTES

  1. Acknowledgments: We thank R. Lewis and B. Traynor for help with Southern blotting, P. Cooper for assistance with PCR genotyping of C9ORF72 repeat patients, and C. A. Thornton for providing technical advice on performing RNA FISH. Funding: This work was supported by NIH grants NS055980 and NS069669 (to R.H.B.) and U24NS07837 (to C.N.S.) and the California Institute for Regenerative Medicine grant RT2-02040 (to C.N.S. and D.S.). R.H.B. holds a Career Award for Medical Scientists from the Burroughs Wellcome Fund. Analytical work was partially supported by the University of California at Los Angeles (UCLA) Muscular Dystrophy Core Center funded by the National Institute of Arthritis, Musculoskeletal, and Skin Disorders (P30 AR057230) within the Center for Duchenne Muscular Dystrophy at UCLA. L.P. was supported by Mayo Clinic Foundation. This work was also supported by the NIH/National Institute on Aging (R01 AG026251 to L.P.), the NIH/National Institute of Neurological Disorders and Stroke (R21 NS074121 to T.G., R01 NS063964 to L.P., R01 NS077402 to L.P., and R21 NS084528 to L.P.), the National Institute of Environmental Health Services (R01 ES20395 to L.P.), and the Amyotrophic Lateral Sclerosis Association (to L.P.). Author contributions: D.S., J.G.O., S.G., M.S., A.K.M.G.M., S.B., S.C., M.B., T.G., L.P., P.M., T.S.O., J.R., M.B.H., F.R., C.F.B., C.N.S., and R.H.B. participated in the planning, design, and interpretation of experiments. D.S. and M.S. performed iPSC culture, motor neuron differentiation, and survival analysis. J.G.O. performed RAN product and C9ORF72 expression experiments. P.M. performed electrophysiology experiments. S.C., S.G., and S.B. performed 5′RACE experiments and plasmid cloning. A.K.M.G.M. performed FISH and immunocytochemistry experiments. M.B.H. performed Southern blots. D.S., C.N.S., and R.H.B. wrote the manuscript. Competing interests: C.F.B. and F.R. are employees of Isis Pharmaceuticals and hold stock options in the company. C.F.B. serves on the scientific advisory board of the Experimental Therapeutic Centre, Singapore. C.F.B. has submitted patents related to this work regarding the design and use of ASOs targeting the C9ORF72 transcript.
View Abstract

Navigate This Article